МКОУ "СОШ с. Псыншоко"

МКОУ "СОШ с. Псыншоко"

Добро пожаловать на наш сайт!

Наследственная масса гк: ГК РФ Статья 1112. Наследство / КонсультантПлюс

Когда можно сесть за руль унаследованной машины — Российская газета

Более 700 тысяч автомобилей, зарегистрированных на умерших, выявили в прошлом году сотрудники Госавтоинспекции на дорогах. Однако не все из попавшихся в руки инспекторов были злостными нарушителями. У многих из них одна машина на семью. А срок вступления в наследство — полгода. Что им делать, если машина нужна сейчас? В законах нет четкого ответа на этот вопрос. Зато у ГИБДД есть жесткие правила регистрации, которые не предполагают использования такой машины до вступления в наследство. Хотя Гражданский кодекс предполагает и другие варианты решения вопроса. Юристы считают, что в правилах регистрации эти тонкости не учли, по сути, ограничив права наследников.

С такой проблемой сталкиваются все, у кого машина была зарегистрирована на умершего родственника. Дело в том, что, согласно закону о регистрации транспорта и правилам этой регистрации, после того как собственник умер, машину надо поставить на прикол. Пользоваться ей не имеет права никто из родственников, даже наследники первой очереди. Несмотря в том числе на то, что при жизни владельца они ею пользовались. Доверенности теряют силу, договор ОСАГО также должен прекратить свое действие, да и регистрация автомобиля должна быть прекращена.

Поставить машину сразу на учет закон о регистрации наследнику не позволяет. Ведь для этого нужен документ, подтверждающий право собственности. Это свидетельство о вступлении в наследство. Получить же его можно только через полгода после смерти собственника.

Как пояснил корреспонденту «РГ» юрист Кирилл Муратов, действующие правила регистрации нарушают права наследников. Например, пользоваться квартирой наследник может, а автомобилем — нет. В пункте 1 статьи 1152 ГК прописано, что для приобретения наследства наследник должен его принять.

Способы принятия наследства установлены статьей 1153 Гражданского кодекса Российской Федерации. В первом ее пункте сказано, что принятие наследства осуществляется подачей нотариусу по месту открытия наследства заявления о принятии наследства либо заявления наследника о выдаче свидетельства о праве на наследство.

— Из системного толкования можно сделать вывод о том, что после смерти гражданина и получения таких сведений органами, осуществляющими регистрацию, мероприятия, связанные с прекращением этой регистрации, автоматически приводят к ограничению прав наследников, — утверждает Кирилл Муратов. — В том числе в части сохранения такого имущества, поскольку его перемещение становится невозможным. При этом в правилах регистрации нет ни пояснений, ни документов, позволяющих наследникам обратиться в регистрационные органы, чтобы пользоваться имуществом до получения свидетельства о праве на наследство. Например, заверенное нотариусом соглашение о пользовании имуществом, находящимся в наследственной массе.

Госавтоинспекция прекращает регистрацию, а затем вылавливает на дорогах такие автомобили потому, что некоторые их владельцы пользуются тем, что на умершего невозможно выписать штраф. А с учетом того, что более 80 процентов нарушений выявляются с помощью фотовидеофиксации, те, кто ездит на машинах, принадлежащих умершим, остаются безнаказанными.

В правилах регистрации транспорта не предусмотрена возможность наследников пользоваться имуществом до получения свидетельства о наследстве

Но не все автовладельцы такие. Упирая на отлов злостных нарушителей, пользующихся автомобилями умерших, как-то забыли защитить права добросовестных автовладельцев, лишив их права зарегистрировать автомобиль на себя, хотя бы на время до вступления в наследство.

Решить проблему можно было бы внесением соответствующих поправок в закон о регистрации транспортных средств. А пока юрист готовит жалобу в Верховный суд.

Принять наследство: инструкция — новости Право.ру

Главные вопросы

Пресс-служба Федеральной нотариальной палаты и нотариус города Москвы Татьяна Ништ по просьбе «Право.ru» рассказали про самые частые ошибки, которые встречаются при вступлении в наследство, несмотря на известные нормы (например, полугодовой срок для вступления в наследство). Также Ништ рассказала про первые месяцы работы законов блока так называемой наследственной реформы. 

Какая самая распространённая ошибка при вступлении в наследство?

Самая распространённая ошибка – несвоевременное обращение к нотариусу. Все слышали про шестимесячный срок для вступления в наследство, но не все знают, для чего он нужен. 

Шесть месяцев даётся всем наследникам, чтобы заявить о себе. Потом нотариус выдаёт свидетельство о праве на наследство наследникам, которые вовремя приняли наследство. Иногда этот срок может быть увеличен.

Обзор практики ВС

Если наследник срок пропустил или вовсе не обратился к нотариусу, то ему нужно будет доказать, что он фактически принял наследство. То есть управлял наследством, защищал его от расхищения и содержал имущество за свой счёт (например, платил за квартиру). Иначе нужно будет через суд восстанавливать сроки для принятия наследства, чтобы доказать, что причина пропуска была уважительной.

Если наследник не подавал заявление и у нотариуса нет сведений о том, что наследство принято кем-то из наследников фактически, то имущество умершего можно посчитать выморочным. Так называют имущество, на которое не нашлось претендентов. Оно переходит в собственность государства (по правилам ст. 1151 ГК).


Куда направлять заявление?

Частая ошибка – это направление заявления в нотариальную палату. Заявление нужно отправлять именно по последнему месту жительства умершего (п. 1 ст. 1152 Гражданского кодекса). Если же этот документ подали в нотариальную палату, то он не будет учитываться.

Часто заявления направляют по почте, но при этом подлинность подписи не заверил нотариус. Такое заявление тоже не может рассматриваться. При этом в течение полугода наследник может устранить все недостатки и принять наследство.

То есть после смерти наследодателя в течение шести месяцев (а не позднее) нужно обратиться к нотариусу (не в нотариальную палату) и подать заявление о принятии наследства либо о выдаче свидетельства о праве на наследство. Поданное заявление – самое бесспорное подтверждение принятия наследства.  

Про обновления 

Практика по удостоверению совместных завещаний и наследственных договоров ещё не сформировалась. На что можно обратить внимание уже сейчас, так это значительная степень свободы в части изменения уже сформированной воли супругов в совместном завещании или сторон наследственного договора. 

Один из супругов в любое время, в том числе после смерти другого супруга, вправе совершить последующее завещание, а также отменить совместное завещание супругов (по п. 4 ст. 1118 ГК). А согласно п. 10 ст. 1140.1 ГК, наследодатель вправе совершить в любое время односторонний отказ от наследственного договора, если уведомит всех причастных о таком решении. Но при этом он обязан возместить другим сторонам наследственного договора убытки, которые появились из-за исполнения наследственного договора. 

После заключения наследственного договора наследодатель может совершать любые сделки с имуществом, даже если такое распоряжение лишит лицо, которое может быть призвано к наследованию, прав на имущество наследодателя. И в этом случае закон ничего не говорит о возмещении убытков другим сторонам наследственного договора.


В чём же разница между наследственным договором и договором ренты?

Принципиальное отличие наследственного договора от договора пожизненной ренты или договора пожизненного содержания с иждивением – это момент перехода права собственности на имущество, переданное по этим договорам. Плательщик ренты становится собственником имущества уже при жизни получателя ренты. При передаче имущества по наследственному договору потенциальный наследник станет собственником имущества только после смерти наследодателя. 

То есть при заключении наследственного договора наследодатель свободен в распоряжении своим имуществом; при передаче имущества по договору ренты получатель ренты, не являясь собственником, уже не может отчуждать переданное по договору имущество, а собственник (плательщик ренты) вправе распоряжаться имуществом, но с существенными ограничениями. Например, недвижимое имущество, переданное плательщику ренты, может отчуждаться им только с согласия получателя ренты.

Если получатель пожизненной ренты или пожизненного содержания умирает, то обременение имущества, переданного под выплату ренты, прекращается. А если умер плательщик ренты, то имущество, переданное под выплату ренты, входит в его наследственную массу и наследуется его наследниками.


Общий порядок

Необходимо получить свидетельство о смерти – его отдадут в ЗАГС в обмен на паспорт умершего и медицинское свидетельство о смерти. Если другие родственники получили его за вас, но вы тоже претендуете на наследство, воспользуйтесь ресурсом «Розыск наследников», там вы можете ввести Ф.И.О. умершего и увидеть, открыто ли наследственное дело. Там же указаны контакты нотариуса, который его ведёт. Такое дело на человека может быть только одно: завести другое не получится, дела будут объединены. 

Вы получили свидетельство о смерти, с ним вы идёте к нотариусу. Если вам известен перечень имущества умершего, то самым быстрым способом получения наследства будет принести все сопутствующие документы нотариусу. Тут речь идёт о документах на недвижимость, машину и т. д. С момента, как вы обратились к специалисту, нотариус открывает наследственное дело. В его рамках он распределяет по законным основаниям имущество между наследниками и проверяет права каждого из них. Наследникам также необходимо оплатить госпошлину: для наследников первой очереди и второй она будет меньше, чем для прочих наследников. Она исчисляется исходя из стоимости имущества. Например, для земельного участка она может считаться из его кадастровой стоимости. 

Если об имуществе покойного вам неизвестно, то нотариус может помочь его найти, но это не является его обязанностью. При этом у него есть полномочия отправить запросы в банки, госорганы или юрлицам. Вы можете предположить, что принадлежало покойному, а нотариус может это проверить. 

Самым главным документом в наследовании является свидетельство о праве на наследство. С ним можно оформить собственность на недвижимость (в Росреестре) или зарегистрировать на себя автомобиль (в ГИБДД). 

Само по себе завещание меняет только естественный порядок наследования. Узнать, составлено ли завещание, можно также у нотариуса. Все завещания внесены в единый реестр.

Признание недостойным одного из наследников

1 ситуация:

В п.1 ст. 1117 ГК РФ даётся определения понятия недостойного наследника. Из его содержания следует, что им является лицо, которое:

  • умышленно совершает противоправные действия против самого наследодателя и его воли, содержащейся в завещании, а также против непосредственных наследников. Фактически или потенциально совершало попытки призвания к наследованию его самого или третьих лиц.
  • Фактически или потенциально совершало попытки, направленные на то, чтобы увеличить размер доли наследства для него самого или третьих лиц.

Если данное нарушение будет установлено судом, то согласно общему порядку, данные лица лишаются права на наследство как по завещанию, так и по закону. Закон устанавливает и иную группу лиц, которые не могут претендовать на наследство. Это родители детей, лишенные родительских прав по решению и суда. Причём данное не должно быть восстановлено к моменту, когда наступило открытие наследства.

Совершение противоправных действий по отношению к наследникам и самому наследодателю непосредственно влечёт признание такого лица недостойным наследником (к примеру, в случае совершения покушения на жизнь или здоровье перечисленных лиц).

Таким образом, для признания наследника недостойным должно иметь место противоправное деяние, поэтому нельзя рассматривать отсутствие ухода за наследодателем как основание для отстранения такого лица от наследства.

Примеры поступков, которые характеризуются как противоправное деяние в отношении воли наследодателя:

  • Подделка, хищение или уничтожение завещания.
  • Принуждение наследодателя к исправлению завещания.
  • Побуждение или угрозы в отношении наследников, целью которых является отказ данных лиц от принятия наследства.
  • Исключение недостойного наследника производится исключительно через суд, в случае если иное не установлено завещанием.

Для этого заинтересованное лицо должно совершить следующие действия:

  1. Подготовить иск;
  2. Оплатить госпошлину и предоставить чек об ее уплате.
  3. Подготовить полный перечень документов, которые могут подтвердить факт совершения противоправных действий ответчика.
  4. Обратиться с комплектом документов в судебный орган.

2 ситуация:

Для принятия наследства законом определён шестимесячный срок. Если наследник пропустил данный срок и не принял наследство, согласно ст. 1155 ГК РФ он вправе обратиться в суд за восстановлением указанного срока и признанием его в качестве наследника, который принял наследство. Для того что воспользоваться данным правом требуется соблюдение ряда условий:

  • Наследник не был извещён об открытии наследства и не мог знать об этом.
  • Наследник может подтвердить наличие уважительных причин, препятствовавших принятию наследства.

Заинтересованное лицо должно обратить в суд с соответствующим заявлением о пропуске установленного срока сразу после устранения причин, не позволяющих ему вступить в наследство.

Если суд определит заявителя в качестве лица, принявшего наследство, то далее будут определены имущественные доли других наследников. При необходимости возможно осуществление мер, целью которых является защита прав на наследство нового наследника. Свидетельства, подтверждающие права на наследство, которые были выданы ранее, будут признаны недействительными.

Наследник, пропустивший срок принятия наследства, может быть восстановлен в данном праве не только по суду, но и в случае, если другие наследники выразят своё согласие на это в письменном виде. Такой документ должен быть заверен нотариусом и выступает основанием для того чтобы аннулировать оформленные ранее свидетельства на право наследования и выдать новые.

Если согласно ранее выданному свидетельству наследственное имущество было зарегистрировано, то аннулирование предыдущих документов о праве наследства влечёт необходимость внесения изменений в запись о госрегистрации.

Восстановление срока для того чтобы вступить в наследство возможно если суд признает причины пропуска уважительными (к примеру, нахождение лица за пределам РФ), либо будет доказан факт того что лицо не было оповещено о смерти наследодателя, то есть не могло знать о начале отсчета данного срока.

3 ситуация:

Как доказать тот факт, что наследник пропустил срок открытия наследства по причине того, что не знал и не должен был знать о нем.

Обоснованность неосведомленности о данных обстоятельствах устанавливается индивидуально в каждом случае по суду. Анализ судебной практики показывает, что наиболее часто уважительными причинами для пропуска срока являются:

  • Отсутствие контактов с наследодателем и другими наследниками.
  • Длительное нахождение в другом городе или стране.
  • Тяжелые заболевания.

Для того чтобы подтвердить обоснованность пропуска срока заявитель может предоставить:

  • Показания свидетелей.
  • Соответствующие справки из медучреждений.
  • Документы о регистрации с места своего нахождения.

4 ситуация: Существуют ли преимущественные права на получение наследства у несовершеннолетних и родных детей перед совершеннолетними или приемными?

П. 2 ст. 1141 ГК РФ определяет принципы общего правила при распределении наследства, таким образом, наследники одной очереди в равных долях имеют право на имущество наследодателя.

Касаемо наследования по закону в соответствии с п.1. ст. 1147 кровными родственниками признаются усыновитель и его родственники и усыновлённый с его потомством с другой стороны. Это объясняет отсутствие приоритетных прав не зависимо от кровных связей и возраста.

5 ситуация: оспаривание завещания, составленного под давлением или в результате обманных действий, а так же в случае помутнения рассудка завещателя.

Заинтересованное лицо вправе обратиться за оспариванием с исковым заявлением в суд. К этим лицам относятся:

  • Родственник наследодателя, который был лишён наследства.
  • Наследник по завещанию.
  • Отказополучатель.
  • Прокурор.
  • Физическое или юридическое лицо, которое претендует на завещательное возложение.
  • Лицо, уполномоченное на исполнение воли наследодателя.

В ст. 1131 ГК РФ даны основания, позволяющие признать завещание недействительным:

  • Если завещание является оспоримым, то есть признано таковым по суду.
  • Если завещание ничтожно вне зависимости от признания.

Лицо, чьи права и интересы нарушены завещанием, вправе обратиться в суд за признанием данного завещания недействительным. Оспорить завещание до того момента, как на него будет открыто наследство нельзя. Кроме случаев совместного завещания супругов. Стоит отметить, что завещание может быть признано судом недействительным полностью или в отдельной части.

Имеют место и иные условия, позволяющие признать завещание недействительным:

  • Завещатель – недееспособное лицо (данный факт устанавливается судом).
  • Завещать находился в заблуждении и не мог оценить правовые последствия оформления завещания.
  • Завещание было составлено гражданином, не отдающим отчет своим действиям в результате алкогольного, наркотического или токсического опьянения, либо по причине болезни.
  • Наследниками был установлен факт фальсификации.
  • Волеизъявление завещателя противоречит закону.

Анализ существующей судебной практики показывает, что данные основания редко принимаются судом во внимание при оспаривании завещаний. Поскольку этот документ требует заверения нотариусом. Тот в свою очередь проверяет дееспособность завещателя, его волеизъявление, разъясняет последствия совершаемых юридических действий.

Порядок и сроки оспаривания завещания:

  • 1 год для оспоримых завещаний. Срок отсчитывается с момента, когда лицо узнало о нарушении своих прав и интересов (п.2 ст.181 ГК РФ).
  • 3 года для ничтожных завещаний. С того момента, когда было открыто наследство либо с того дня, когда наследник усомнился в законности завещания (п.1 ст.181 ГК РФ).

При жизни наследодателя оспорить завещание невозможно. Подача иска допускает лишь с момента открытия наследства согласно п.2 ст.1131 ГК РФ.

Порядок действий заинтересованного лица:

Преемник должен обратиться в суд с исковым заявлением по месту проживания. Дополнительно истец обязан предоставить полный перечень документов, которые могут подтвердить следующее:

  • Связь с наследодателем.
  • Доказательства прав на получение наследства.
  • Документы, подтверждающие существование и открытие наследства.

К заявлению предъявляются процессуальные требования, согласно которым, в нем указывается:

  • Данные заявителя.
  • Наименование судебного органа.
  • Обстоятельства и непосредственная суть самой претензии.
  • Доказательства, свидетельствующие о правоте истца.
  • Личная подпись заявителя и дата оформления документы.

Помимо заявления, истец предоставляет:

  • Копию документа, подтверждающего личность заявителя.
  • Справку о смерти наследодателя.
  • Завещание.
  • Квитанцию, подтверждающую оплату госпошлины.

Ситуация 6: Оспаривание сделок, совершенных наследодателем до момента смерти, которые повлекли ущемление прав наследников

Ст. 1112 ГК РФ содержит определение касаемо состава наследства и устанавливает, что в него входят:

  • Имущество.
  • Вещи.
  • Имущественные права и обязанности.

Согласно Постановлению ВС РФ №9 от 29.05.2012 г. наследники могут обратиться с исковым заявлением в судебные органы с той целью, чтобы признать недействительной сделку, которая была совершена наследодателем на основании ст.177-179 ГК РФ при условии, что при жизни наследодатель не обращался за оспариванием данной сделки.

Из этого следует, что наследодатель вправе совершать любые сделки с имуществом при жизни. В состав наследства войдет только те вещи и имущество, которое являлось собственность наследодателя на момент смерти. Для признания сделки недействительной, заинтересованное лицо должно обосновывать свои требования в соответствии со ст.166-181 ГК РФ. Сделка может не быть определена как недействительная только по причине того, что ущемляет имущественные права наследников.

Ситуация 7: Оспаривание наследниками договора ренты

Наследники вправе обратиться в суд, чтобы оспорить договор ренты, заключенный с наследодателем. Недействительным договор будет признан в случае:

  • Его содержание нарушает требования законодательства.
  • Цели сделки противоречат основам нравственности и правопорядка.
  • Договор является притворным и мнимым.
  • Одна из сторон сделки – недееспособный гражданин.
  • Одна из сторон сделки – гражданин, не достигший 14-ти летнего возраста.
  • Цели сделки противоречат деятельности юридического лица.
  • Отсутствует необходимое для совершения сделки согласие третьих лиц (в том числе гос.органов).
  • Действия представителя органа или организации нарушают интересы представляемого.
  • Имущество, выступающее предметом сделки, не допускает или ограничивает совершение правовых действий с ним.
  • Недействительная сделка с участием лица в возрасте от 14 до 18 лет.
  • Одна из сторон сделки лицо, ограниченно дееспособное по решению суда.
  • Одна из сторон сделки гражданин, который не способен оценивать последствия совершаемых действий и руководить ими.
  • На лицо осуществлялось воздействие в виде угроз, обмана, введения в заблуждение или давления касаемо неблагоприятных последствий за отказ в совершении сделки.

Если же договор ренты будет определен как действительный, то повлечет за собой исключение предмета договора из наследственной массы.

Ситуация 8:

В случае если наследник умышленно предпринимал попытки, направленные на то чтобы увеличить размер причитавшейся ему доли, то он может быть лишен права наследования как по завещанию, так и по закону, поскольку является недостойным наследником.

П.3 ст. 1117 ГК РФ не относит к причинам признания завещания недействительным:

  • Незначительные нарушения.
  • Описки и опечатки.
  • Нарушение процедуры составления, подписания и нотариального удостоверения.

в случае если данные факторы не оказывают влияния на понимание содержания завещания.

Каждая ситуация является индивидуальной и требует отдельного анализа и установления фактов умысла наследников в отношении воли завещателя.

Ситуация 9: Обнаружение нотариусом имущества наследодателя

Отыскать имущество наследодателя возможно посредством подачи запросов в уполномоченные ведомства. По запросу нотариуса ему должна быть предоставлена информация об имуществе наследодателя из любого юридического лица, кредитной организации или банка.

Чтобы сформировать наследственную массу, нотариус вправе запросить выписку из ЕГРН или ЕГРЮЛ, чтобы установить право наследодателя на недвижимость или долю уставном капитале компании. Однако некоторые документы могут находиться исключительно в распоряжении наследника, например: договор дарения или купли-продажи. Предоставляя такого рода документы, наследники способствуют значительному ускорению процесса формирования наследственной массы.

Если вы, как наследник, обладаете сведениями касаемо собственности наследодателя или иного принадлежащего ему имущества, сообщите эти данные нотариусу. Если права на имущество зарегистрированы не надлежащим образом, то потребуется обращение в суд для включения его в наследственную массу. Чтобы доказать факт владения спорным имуществом, заинтересованное лицо должно предоставить все доказательства, свидетельствующие о том, что оно принадлежало и находилось во владении наследодателя. В случае удовлетворения исковых требований, данное имущество будет включено в наследственную массу и наследоваться согласно установленным правилам. все статьи

Палата

Проблемы наследования выморочного имущества

В российском наследственном праве, равно как и в праве иных государств, существует понятие выморочного имущества. Институт выморочного имущества имеет большое социальное и правовое значение и заключается в устранении бесхозяйственности объектов наследства.

Современное законодательство решает вопрос наследования выморочного имущества следующим образом. Правила наследования выморочного имущества начинают применяться только в случае, когда никто из наследников не имеет права наследовать, или все наследники отстранены от наследования, или никто из них не принял наследство, или все наследники отказались от наследства и при этом никто из них не указал, что отказывается в пользу другого наследника.

По общему правилу выморочное имущество переходит в собственность Российской Федерации. Можно предположить, что Российская Федерация является своеобразной девятой очередью наследников по закону. Исключением из общего правила являются выморочные жилые помещения. Причем данное исключение появилось после введения в действие части третьей Гражданского Кодекса Российской Федерации (ГК РФ).

В соответствии с п.2. ст.1151 ГК РФ если выморочное имущество в виде расположенного на территории Российской Федерации жилого помещения находится в конкретном муниципальном образовании, то оно переходит в порядке наследования по закону в собственность муниципального образования, а если оно расположено в субъекте Российской Федерации – городе федерального значения Москве или Санкт-Петербурге, в собственность такого субъекта. Данное жилое помещение включается в соответствующий жилищный фонд социального использования.

Включение в круг наследников муниципальных образований (городов федерального значения) породило следующую проблему: наследование – это универсальное правопреемство, а после внесения изменений в ст.1151 ГК РФ наследственная масса «распадается» на две части – жилое помещение или иное имущество. Муниципальные образования выступают сингулярными правопреемниками: они приобретают право только на жилое помещение и любые имущественные обязанности перед кредиторами умершего в пределах его стоимости. Поэтому муниципальное образование (город федерального значения) не может быть единственным наследником. В соответствии с п.1 ст.1175 ГК РФ Российская Федерация всегда становится сонаследником и несет солидарную ответственность по долгам умершего.  Государство является наследником, даже если наследство выражено только жилым помещением, иначе не будет универсального правопреемства, ведь в муниципальную собственность переходит только определенное имущество, а не вся совокупность имущественных прав.

Пробелом является и то, что в ГК РФ не регулируется вопрос о выморочном имуществе, находящемся за пределами Российской Федерации. Вероятнее всего, такое выморочное имущество также переходит в собственность Российской Федерации. Правила наследования определяются в соответствии с ГК РФ, международными договорами, заключенными Российской Федерацией с иностранными государствами: наследственное имущество как выморочное переходит в собственность государства, то движимое имущество передается государству, гражданином которого к моменту смерти являлся наследодатель, а недвижимое – в собственность государства, на территории которого она находится.

Главной и существенной проблемой является и то, что в отношении остального имущества применяются нормативно-правовые акты, принятые еще в СССР, так как специальный закон, регулирующий данные правоотношения, отсутствует. Это и является причиной многих пробелов в законодательстве, вызывающих проблемы на практике.

Еще одной проблемой является пропуск срока на принятие наследства. По общему правилу данное обстоятельство ведет к утрате соответствующих прав, если в суде пропущенный срок не восстановлен или всеми наследниками, принявшими наследство, не дано согласия в письменной форме на принятие наследства по истечении срока (п.1, 2 ст.1155 ГК РФ).

Порядок наследования выморочного имущества должен определяться специальным федеральным законом, где должны быть более детально определены имущество, переходящее в собственность субъектов Российской Федерации и муниципальных образований, особенности такой процедуры, отражены условия и порядок возврата такого имущества наследникам, а также установлены компенсации и гарантии при невозможности возврата наследственного имущества в натуре наследникам, а также тем лицам, которым указанное имущество уже было передано в собственность либо пользование. Также должны быть определены органы и лица, обладающие полномочиями по выявлению случаев выморочного имущества и передаче информации о них соответствующим государственным органам, принимать меры охраны такого имущества, вступать во взаимодействие с нотариальными органами и др.

Нотариус Абаканского
нотариального округа
Республики Хакасия
Бусыгина Зинаида Ивановна


 <<< Возврат к списку

Основные понятия и принципы наследственного права в соответствии с V разделом ГК РФ

Наследственное право представляет собой единственную отрасль права, предметом регулирования которой являются общественные отношения касательно прав и обязанностей умершего человека. В юридической науке главенствует правило, согласно которому после физической смерти лицо теряет статус субъекта правоотношений. В связи с этим права и обязанности умершего переходят к другому человеку. Нормы наследственного права регулируют порядок перехода этих юридических притязаний правопреемникам, то есть наследникам.

Наследственному правопреемству присущи следующие характеристики:

  1. Переход имущества по наследству не всегда необходимо и возможно. Права, тесно связанные с личностью умершего лица, не переходят наследникам. Таковыми являются, к примеру, право авторства, право на алименты и другие.
  2. Наследственное правопреемство касается только имущества физических лиц. Правовые последствия прекращения юридического лица не регулируются этой отраслью.
  3. Наследственное правопреемство носит универсальный характер. Наследнику переходят все имущественные обязанности и права. Он не вправе отказаться от части наследственной массы и принять лишь часть имущества.
  4. Правопреемство носит непосредственный характер. Переход имущества осуществляется напрямую от наследодателя к наследнику. Участие третьих лиц в этом процесса запрещено. Встречается ситуация, когда умерший человек обязывает наследника переоформить одну часть передаваемого имущества на имя третьего лица. В этом случае правопреемник не является наследником в традиционном понимании. ГК РФ именует это лицо отказополучателем, или сингулярным правопреемником.

Основные категории наследственного права

Наследодатель – это умерший человек, в собственности которого находилось имущество. В качестве наследодателей могут выступать и дееспособные, и недееспособные лица.

Наследник – это лицо, которое получает имущество после смерти другого лица. В качестве наследника могут выступать не только граждане, но и юридические лица и государственные организации. Необязательно, чтобы наследник родился до смерти наследодателя. Ребенок, зачатый при жизни собственника имущества и рожденный после его смерти, тоже считается полноценным субъектом наследственных правоотношений.

В законодательстве четко указывается, что родители, которых лишили родительских прав, не могут претендовать на имущество своих умерших детей. Такое же правило в обратном направлении действует в отношении детей, которые злостно уклонялись от содержания своих родителей при их жизни.

Наследственная масса представляет собой весь комплекс имущественных прав и обязанностей, передаваемых в порядке наследственного правопреемства.

Открытием наследства называется начало наследственных правоотношений. Этим временем считается момент смерти лица, которое закрепляется в медицинском заключении. А если лицо признано умершим на основании вердикта суда, то открытие наследства наступает после вступления в юридическую силу судебного решения. Значение этого подинститута наследственного права проявляется при определении состава наследственной массы, при её принятии или в отказе от неё.

Различаются два вида наследования по ГК РФ:

  • По завещанию. Считается первостепенным видом наследственного правопреемства. Собственник имущества свободен в распоряжении им. Поэтому он правомочен определять судьбу своей собственности после своей смерти, что и выражается в составлении завещания.
  • По закону. Наследственное правопреемство по закону осуществляется, только если отсутствует завещание, или же имеющееся завещание не отвечает требованиям законодательства. ГК РФ различает очереди наследников, которые становятся собственниками имущества в субсидиарном порядке. Это означает, что наследник второй очереди может претендовать на имущество только при отсутствии наследников первой очереди.

Принципы наследственного права

В системе наследственного права принято выделять 6 основных принципов:

  1. Универсальное наследственное правопреемство. Собственность умершего лица переходит к правопреемнику как единый комплекс.
  2. Свобода завещания. Этот принцип перекликается с принципом диспозитивности. Завещатель свободен в оформлении завещания, никаких ограничений в распоряжении собственностью быть не может. При этом за лицом, написавшим завещание, сохраняется право не разглашать его содержание. Завещание как односторонняя сделка может быть изменена или отменена в одностороннем порядке в любой момент. Существует единственное ограничение при реализации принципа свободы завещания: наследовать право получения процентных выплат с перепродажной цены по завещанию нельзя, равно как и юридическое лицо не может получить ренту с имущества.
  3. Обеспечение прав и интересов наследников. Данный принцип в какой-то мере противоречит правилу о свободе завещания. Государство установило в ГК РФ определённую категорию лиц, которые получают долю в наследственной массе, даже если они не указаны в тексте завещания. Их принято называть необходимыми наследниками. В эту категорию относятся нетрудоспособные и несовершеннолетние близкие родственники, а также иждивенцы умершего человека. Допускается признание этих правопреемников недостойными, если они выполняли противоправные действия в отношении наследника.
  4. Учет предполагаемой воли наследодателя. Не всегда при составлении завещания учитываются все нюансы законодательства. Нередко встречаются ситуации, когда завещатель не указывает все объекты собственности, принадлежащие ему. В таком случае остальная часть имущества делится между правопреемниками на основании законодательных предписаний об очередях наследников.
  5. Свобода выбора наследников. Данный принцип частично сходится с принципом свободы завещания.
  6. Охрана наследственной массы от противоправных посягательств и безнравственных действий третьих лиц. Наследуемое имущество не сразу переходит к правопреемникам. До тех пор, пока определятся круг всех наследников, назначается управляющий наследственной массой, который отвечает за целостность и сохранность объектов собственности.

Что говорит судебная практика?

ВС РФ в определении №23-КГ18-5 от 15.01.2019 пришел к выводу, что если брак был признан недействительным, но во время судебных разбирательств вопрос о разделе совместно нажитого имущества не поднимался, то лицо не лишается права на долю в наследственной умершего супруга по «недействительному браку».

Суть дела заключалась в том, что истица обратилась в суд с требованием признать её права на квартиру и автомобиль (так называемая супружеская доля) в порядке наследственного правопреемства по закону. Однако ранее судебным решением брак этих лиц был признан недействительным, так как муж на момент регистрации данного брака уже был женат. Суд первой инстанции удовлетворил исковые требования, приняв во внимание факт добросовестности супруги. Она не знала, что у её мужа уже был другой зарегистрированный брак. Следовательно, за супругой сохраняется право на супружескую долю на основании статьи 30 Семейного кодекса РФ.

Ст. 1112 ГК РФ с Комментариями 2020-2021 года (новая редакция с последними изменениями)

В состав наследства входят принадлежавшие наследодателю на день открытия наследства вещи, иное имущество, в том числе имущественные права и обязанности.

Не входят в состав наследства права и обязанности, неразрывно связанные с личностью наследодателя, в частности право на алименты, право на возмещение вреда, причиненного жизни или здоровью гражданина, а также права и обязанности, переход которых в порядке наследования не допускается настоящим Кодексом или другими законами.

Не входят в состав наследства личные неимущественные права и другие нематериальные блага.

Комментарий к Ст. 1112 ГК РФ

1. В комментируемой статье определяется объект наследственного правоотношения, т.е. состав имущества, переходящего в порядке наследования от наследодателя к другим лицам (наследникам). Традиционно такое имущество именуется наследственным имуществом, наследственной массой, наследством.

2. В состав наследства входит все имущество, принадлежавшее наследодателю на день смерти, — все, что у него было, переходит к наследникам (кроме того, что указано в абз. 2 комментируемой статьи).

Бесплатная юридическая консультация по телефонам:

3. В гражданском законодательстве термин «имущество» используется неоднозначно. В некоторых случаях под имуществом понимаются вещи — предметы материального мира, могущие быть в обладании людей и служащие удовлетворению их потребностей (ст. ст. 130, 209 ГК и т.д.). Иногда под имуществом понимаются вещи, принадлежащие субъекту, и его имущественные права. Например, в силу ст. 56 ГК РФ юридические лица (за исключением учреждений) отвечают по своим обязательствам всем принадлежащим им имуществом. Понятно, что отвечать можно только активом (вещами и правами), но не пассивом (долгами, обязанностями). Стало быть, в данном случае (ст. 56 ГК) об имуществе говорится как о вещах и имущественных правах. Наконец, нередко под имуществом разумеется все имеющееся у субъекта: вещи, права и обязанности. Именно в этом смысле определяется наследство в комментируемой статье.

Справедливости ради надо отметить алогичность, присутствующую в доктрине и законодательстве при определении наследства (наследственного имущества, наследственной массы). Коль скоро при наследовании имущество умершего переходит к другим лицам в порядке универсального правопреемства (п. 1 ст. 1110 ГК), т.е. как совокупность прав и обязанностей, то вещи в составе наследства (наследственного имущества, наследственной массы) упоминаться не должны. Ведь по наследству переходит право собственности на эти вещи. Но так сложилось исторически: по наследству переходят вещи, права и обязанности наследодателя.

4. В абз. 2 комментируемой статьи указано то, что не может входить в состав наследства (наследственного имущества, наследственной массы). При этом произведено деление того, что не входит в состав наследства, на две группы.

Во-первых, в абз. 3 комментируемой статьи указано то, что никак не может входить в состав наследства в силу неспособности к обороту (переходу от одного лица к другому). Так, невозможна передача одним лицом другому личных имущественных прав и других нематериальных благ, таких как жизнь и здоровье, достоинство личности, личная неприкосновенность, честь и доброе имя, деловая репутация, неприкосновенность частной жизни и др. (см., в частности, ст. 150 ГК).

Во-вторых, по наследству нельзя передать права и обязанности, которые неразрывно связаны с личностью наследодателя (абз. 2 ст. 1112 ГК). Характеристики таких прав и обязанностей в законе не дается, что, как представляется, невозможно — речь идет об оценочных категориях. Вместе с тем среди такого имущества, с одной стороны, четко обозначены права, не переходящие по наследству: право на алименты, право на возмещение вреда, причиненного жизни или здоровью гражданина (перечень этот неисчерпывающий). С другой стороны, в состав наследства не входят права и обязанности, переход которых в порядке наследования не допускается гражданским законодательством (ГК РФ и другими федеральными законами). Так, в силу ст. 418 ГК РФ обязательство прекращается смертью должника, если исполнение не может быть произведено без личного участия должника либо обязательство иным образом неразрывно связано с личностью должника; обязательство прекращается смертью кредитора, если исполнение предназначено лично для кредитора либо обязательство иным образом неразрывно связано с личностью кредитора. Следовательно, соответствующие обязанности и права в состав наследственной массы не включаются, так как они со смертью наследодателя прекратились.

2. Разъяснить судам, что в соответствии с Постановлением Олий Мажлиса Республики Узбекистан от 29 августа 1996 года № 257-1 «О порядке введения в действие Гражданского кодекса Республики Узбекистан» действие статей 1112 — 1157 Гражданского кодекса распространяется и на наследство, открывшееся до введения в действие Кодекса, но не принятое никем из наследников и не перешедшее по праву наследования в собственность органа самоуправления граждан или государства до 1 марта 1997 года.3. В соответствии со статьей 1113 ГК в состав наследства входят принадлежащее наследодателю на момент открытия наследства движимое и недвижимое имущество, вещи, все имущественные права и обязанности, существование которых не прекращается с его смертью, в частности, право частной собственности, право на сбережения, хранимые в кредитных учреждениях, право пожизненного наследуемого владения земельным участком дехканского хозяйства (статья 9 Закона «О дехканском хозяйстве»), право аренды земельного участка (статья 12 Закона «О фермерском хозяйстве») и т. п.По закону (часть вторая статьи 1113 ГК) в состав наследства не входят следующие права и обязанности, неразрывно связанные с личностью наследодателя: 6. При рассмотрении споров о наследовании лиц, которые в силу части первой статьи 1119 ГК могут быть признаны недостойными наследниками, необходимо иметь в виду, что их противозаконные действия, способствовавшие призванию к наследованию, установленные вступившим в законную силу приговором суда, являются основанием к лишению права наследования лишь при умышленном характере этих действий.11. В соответствии с частью второй статьи 1112 ГК наследование по закону имеет место лишь тогда, когда завещание отсутствует либо не определяет судьбу всего наследства, а также в иных случаях, предусмотренных ГК. В соответствии со статьей 1142 ГК наследуют по закону также несовершеннолетние или нетрудоспособные дети (в том числе усыновленные) завещателя, его нетрудоспособные супруг и родители (усыновители), имеющие право на обязательную долю. При этом необходимо иметь в виду, что наследники по праву представления, нетрудоспособные иждивенцы наследодателя, наследники второй и последующих очередей по закону не имеют права на получение обязательной доли. 20. В соответствии со статьей 1150 ГК в случае недостижения между наследниками соглашения о разделе наследства, выделе из него доли раздел производится в судебном порядке по требованию любого из них.

Наследственный лейомиоматоз и почечно-клеточный рак

Что такое наследственный лейомиоматоз и почечно-клеточный рак?

Наследственный лейомиоматоз и почечно-клеточный рак (HLRCC) — это наследственное заболевание, связанное с развитием множественных лейомиом (опухолей гладких мышц) кожи и матки (миомы), а также агрессивной формой рака почки. HLRCC может выглядеть у пациента по-разному, от легкой до тяжелой. Эти кожные опухоли обычно развиваются в зрелом возрасте и возникают на груди, спине, руках и ногах.Эти опухоли могут быть болезненными, но они не злокачественные. У женщин с HLRCC миома матки может развиться уже в подростковом возрасте или в возрасте 20 лет. Рак почки чаще всего возникает в зрелом возрасте, но был описан у маленьких детей и подростков.

Что вызывает HLRCC?

HLRCC — это генетическое заболевание. Это означает, что риск рака и других особенностей HLRCC может передаваться в семье из поколения в поколение. Считается, что специфический ген, называемый геном фумаратгидратазы ( FH ), вызывает все известные случаи HLRCC.Исследования продолжаются, чтобы узнать больше об этом состоянии.

Как наследуется HLRCC?

Обычно каждая клетка имеет по 2 копии каждого гена: 1 унаследован от матери и 1 унаследован от отца. Если обе копии FH повреждены в результате наследственной мутации, смерть обычно наступает в течение первых нескольких лет жизни от состояния, известного как дефицит фумаразы.

HLRCC следует аутосомно-доминантному типу наследования, при котором мутация (изменение) происходит только в 1 копии гена.Это означает, что родитель с мутацией гена может передать копию своего нормального гена или копию гена с мутацией. Следовательно, ребенок, у которого есть родитель с мутацией, имеет 50% шанс унаследовать эту мутацию. Брат, сестра или родитель человека, у которого есть мутация, также имеют 50% шанс иметь ту же мутацию. Однако, если тест родителей отрицательный на мутацию (это означает, что результаты тестирования каждого человека не выявили мутации), риск для братьев и сестер значительно снижается, но их риск все равно может быть выше среднего риска.

Текущие исследования показывают, что у человека с HLRCC должна быть вторая мутация в нормальной копии гена FH , чтобы появилась опухоль. В этих случаях человек обычно рождается с 1 мутированным геном (аутосомно-доминантный образец наследования, описанный выше; также называемый мутацией зародышевой линии), а затем приобретает мутацию во второй копии гена FH в какой-то момент во время его или ее жизни. продолжительность жизни в клетках кожи, матки или почек (так называемое соматическое изменение).Затем при изменении обеих копий гена FH организм теряет способность подавлять рост опухоли.

Существуют варианты для людей, заинтересованных в рождении ребенка, когда будущий родитель несет генную мутацию, которая увеличивает риск этого наследственного онкологического синдрома. Преимплантационная генетическая диагностика (ПГД) — это медицинская процедура, проводимая в сочетании с экстракорпоральным оплодотворением (ЭКО). Это позволяет людям, которые являются носителями определенной известной генетической мутации, снизить вероятность того, что их дети унаследуют это заболевание.Для получения дополнительной информации обратитесь к специалисту по вспомогательной репродукции в клинике репродуктивной медицины.

Насколько распространен HLRCC?

HLRCC когда-то считался редким, но с расширением использования тестирования зародышевой линии становится ясно, что это заболевание встречается чаще, чем когда-то предполагалось. Число людей и семей, страдающих этим заболеванием, неизвестно.

Как диагностируется HLRCC?

HLRCC подозревается, если у человека в анамнезе имеется несколько лейомиом кожи. Семейный анамнез фиброидных опухолей, особенно в раннем возрасте, и агрессивная форма рака почки (известная как HLRCC или FH-дефицитный рак почки).Опухоли могут напоминать папиллярный тип 2, собирательный проток или тубулоцитарные формы рака почки. Генетическое тестирование зародышевой линии для поиска мутаций в гене FH доступно для людей с подозрением на HLRCC.

Каковы предполагаемые риски рака, связанные с HLRCC?

HLRCC связан с повышенным риском почечно-клеточного рака. Для людей с HLRCC оценочный риск этого типа рака почки оценивается от 15% до 30%, но пенетрантность или внешний вид этого конкретного признака HLRCC может быть ниже, чем у большего числа людей. все более признанное состояние.

Какие есть варианты скрининга на HLRCC?

Нет никаких конкретных рекомендаций по скринингу для диагностики HLRCC.

Наиболее распространенными вариантами скрининга для людей с диагнозом HLRCC являются регулярные осмотры кожи и исследования поперечного сечения почек с контрастированием, которое представляет собой специальный краситель. Визуализация может включать компьютерную томографию (КТ), которая представляет собой трехмерное изображение внутренней части тела с использованием рентгеновского снимка или магнитно-резонансной томографии (МРТ) каждый год.Поскольку МРТ использует магнитные поля, а не рентгеновские лучи, здесь нет излучения, и поэтому он является предпочтительным методом визуализации. Если обнаружено подозрительное поражение почек, другие виды сканирования, такие как компьютерная томография грудной клетки, ультразвуковое исследование почек или компьютерная томография с позитронно-эмиссионной томографией (ПЭТ-КТ), также могут быть выполнены, чтобы узнать больше о подозрительной области.

Кроме того, женщины должны проходить регулярные гинекологические осмотры и визуализирующие исследования, такие как УЗИ для выявления миомы матки, если матка не была удалена ранее при гистерэктомии.

Рекомендации по скринингу со временем могут измениться по мере развития новых технологий и получения дополнительных сведений о HLRCC. Важно обсудить с вашей медицинской бригадой соответствующие скрининговые тесты.

Узнайте больше о том, чего ожидать от стандартных тестов, процедур и сканирований.

Вопросы, которые следует задать бригаде здравоохранения

Если вас беспокоит риск заболевания раком, поговорите со своим лечащим врачом. Может быть полезно пригласить кого-нибудь на встречи, чтобы делать записи.Вы можете задать своей медицинской бригаде следующие вопросы:

  • Каков мой риск развития рака почки?

  • Что я могу сделать, чтобы снизить риск рака?

  • Какие у меня есть варианты скрининга на рак?

Если вас беспокоит история вашей семьи и вы считаете, что у вашей семьи может быть HLRCC, задайте следующие вопросы:

  • Увеличивает ли мой семейный анамнез риск развития рака почки?

  • Считаются ли поражения кожи или опухоли матки у меня или моей семьи лейомиомами?

  • Указывает ли мой семейный медицинский анамнез на необходимость оценки риска рака?

  • Вы направите меня к генетическому консультанту или другому специалисту по генетике?

  • Стоит ли рассматривать генетическое тестирование?

Связанные ресурсы

Генетика рака

Генетическое тестирование

Чего ожидать при встрече с консультантом по генетике

Сбор семейного анамнеза рака

Обмен результатами генетического теста с семьей

Вопросы и ответы о семейном генетическом тестировании

Дополнительная информация

Семейный альянс по наследственному лейомиоматозу и почечно-клеточному раку

Национальный институт рака

Чтобы найти консультанта по генетическим вопросам в вашем районе, обратитесь к своей медицинской бригаде или посетите следующий веб-сайт:

Национальное общество консультантов по генетике

Наследственные заболевания соединительной ткани: руководство к возникающему дифференциальному диагнозу

В алфавитном порядке ниже перечислены дополнительные факты, дополняющие основную информацию в таблицах.

Аневризмы брюшной аорты

Аневризмы брюшной аорты (ААА) могут присутствовать изолированно или как часть синдрома, такого как сосудистый синдром Элерса-Данлоса (EDS), синдром Лойса-Дитца или синдром Марфана. Идентифицированы три локуса для изолированного AAA: 19q13, 4q31 и 9p21. Однако большинство AAA имеют многофакторную этиологию. 9

Синдром извитости артерий

Синдром извитости артерий отличается от форм СЭД генерализованной извитостью артериального русла.Синдром извитости артерий может включать случайные проявления, такие как паховые и диафрагмальные грыжи, удлинение кишечника, кератоконус, макроцефалия, арахнодактилия, контрактуры суставов и гипотония, в дополнение к более частым признакам, перечисленным в таблице 1 (дополнительный цифровой контент 1, http: // ссылки .lww.com / GIM / A111). Характерные черты лица могут включать характерное удлиненное лицо, микрогнатию, маленький рот, высокое арочное небо, низко посаженные уши, длинный желобок, нос с клювом, наклонные глазные щели, длинные уши и отвисшие щеки. 10,11

Двустворчатый аортальный клапан с аневризмой грудной аорты

Двустворчатый аортальный клапан (ДАК) с аневризмой грудной аорты (TAA) часто связан с кальцификацией аорты, 12 у людей и исследования на мышах и исследованиях показывают, что эти состояния общая этиология через гены, такие как NOTCh2 . 13–15 Лица с нормальным трехстворчатым аортальным клапаном в семьях с BAV / TAA также могут подвергаться риску кальцификации аортального клапана или TAA, особенно если они несут известную семейную мутацию в NOTCh2. 16 Рекомендации по клиническому ведению BAV / TAA могут включать фармакологическую терапию бета-блокаторами и ингибиторами ангиотензинпревращающего фермента или блокаторами рецепторов ангиотензина, агрессивный контроль артериальной гипертензии, ежегодную визуализацию восходящих аорт диаметром> 4,0 см и плановое хирургическое лечение расширенных аорты> 5,0 см в диаметре или> 4,5 см с дополнительными факторами риска. 16

Болезнь Камурати-Энгельмана

Болезнь Камурати-Энгельмана (CED) — редкая костная дисплазия, также известная как прогрессирующая диафизарная дисплазия, в группе заболеваний краниотубулярного гиперостоза, возникающих в результате активации мутаций в трансформирующем факторе роста β1 (TGF- β1), стимулятор роста костей.Сцинтиграфия скелета может использоваться для обнаружения КЭД даже на ранних стадиях. Помимо боли в конечностях (наиболее частый симптом), к другим диагностическим клиническим признакам относятся враждебность, легкая утомляемость и мышечная слабость. Об уменьшении подкожного жира и дефектах черепных нервов, включая потерю слуха, сообщается у части пациентов с КЭД. 17 CED и болезнь Риббинга (OMIM № 601477) являются фенотипическими вариациями одного и того же генетического заболевания.

Синдром CATSHL

Синдром CATSHL означает «камптодактилия, высокий рост и потеря слуха.Этот редкий синдром был идентифицирован в семье с миссенс-мутацией в тирозинкиназном домене FGFR3 , которая, по прогнозам, приведет к частичной потере функции. 18 Как правило, сильные корреляции генотип-фенотип характерны для расстройств, связанных с FGFR . Мутации в FGFR3 преимущественно затрагивают кости, которые развиваются за счет эндохондрального окостенения, тогда как мутации в близкородственных генах, FGFR1 и FGFR2 , оказывают свое основное влияние на кости, развивающиеся за счет внутримембранозного окостенения. FGFR3 мутации могут стимулировать (как в случае CATSHL) или ингибировать (как при ахондроплазиях) рост эндохондральной кости.

Врожденная контрактурная арахнодактилия

Врожденная контрактурная арахнодактилия (CCA) также известна как синдром Билса-Хехта. Классический дисморфизм уха предполагает появление «смятого» вида с загнутой верхней спиралью, хотя эта особенность не всегда присутствует. Медиальная дегенерация проксимального отдела аорты, приводящая к аневризме аорты и, возможно, ее расслоению, иногда наблюдается при ОСА и требует тщательного наблюдения.Контрактуры колен и лодыжек могут присутствовать при рождении и часто улучшаются с возрастом. Также возникают сгибательные контрактуры в мелких суставах пальцев, реже — контрактуры бедра, приведение большого пальца и косолапость. Также сообщалось о парадоксальной слабости надколенника, кератоконусе и стенозе пиелоуретерального перехода. Также была выявлена ​​редкая тяжелая / летальная форма ОСА, которая включает тяжелые сердечно-сосудистые и желудочно-кишечные симптомы. 19 Существенных клинических различий между FBN2-позитивными и FBN2-негативными пациентами не наблюдалось, что свидетельствует о гетерогенности локуса. 20 У FBN2-положительных пациентов частота вывихов суставов значительно выше при миссенс-мутациях FBN2 по сравнению с мутациями сайтов сплайсинга. 21 Доля случаев de novo неизвестна, но у многих пациентов с диагнозом ОСО есть заболевший родитель. 22

Cutis laxa, аутосомно-доминантный

Cutis laxa, аутосомно-доминантный (ADCL) первоначально предполагалось, что включает незначительные системные проявления; однако аневризмы грудной аорты, паховые грыжи и эмфизема теперь признаны серьезными потенциальными клиническими проявлениями. 23–25

Cutis laxa, аутосомно-рецессивный тип I

Cutis laxa, аутосомно-рецессивный AR типа I (ARCLI) имеет худший прогноз в отношении кутис-лаксуса и считается менее распространенным, чем ARCLII. Легочные проявления при ARCLI включают тяжелые сердечно-легочные поражения, включая инфантильную эмфизему и / или надклапанный стеноз аорты. Клинические различия существуют между ARCLI, вызванным FBLN4 и FBLN5 ; например, только FBLN4 был связан с аномалиями, связанными с коллагеном, такими как хрупкость костей и аневризмы артерий среднего размера. 26,27 Генетическая основа большинства случаев ARCLI остается неизвестной. Недавно Morava et al. 28 опубликовали всестороннее сравнение аутосомно-рецессивных синдромов кутислакса.

Аутосомно-рецессивный тип II Cutis laxa

Аутосомно-рецессивный тип II Cutis laxa (ARCLII) часто включает характерную фацию с наклонными вниз глазными щелями, коротким носом и маленьким ртом. Поражение центральной нервной системы и системное поражение варьируют, часто присутствует микроцефалия.Фенотип кожи имеет тенденцию ослабевать с возрастом, тогда как неврологические симптомы могут проявляться или ухудшаться в более позднем возрасте. Большой передний родничок закрывается поздно. Многие пациенты с ARCLII имеют врожденный дефект гликозилирования (CDG типа II, мутация ATP6V0A2), тогда как у других есть дефекты биосинтеза пролина, связанные с морщинистой кожей, остеопенией и появлением прогероидов (мутации PYCR1, P5CS). 29,30 Анализ изоэлектрического фокусирования аполипопротеина C-III, демонстрирующий нарушение O -гликозилирования, является диагностическим, и изоэлектрическое фокусирование трансферрина также может нарушаться.Оценка статуса гликозилирования белков рекомендуется для всех детей с врожденными морщинами кожи / кутислаксии, поздним закрытием родничка, задержкой развития и вариабельным поражением ЦНС. Синдром морщинистой кожи (OMIM № 278250) и ARCLII являются частью спектра фенотипических вариаций, вызванных дефектами одного гена. 31 Фенотип может также перекрываться с остеодисплазией геродермии (OMIM № 231070) и синдромом де Барси (OMIM № 219150).

Cutis laxa, X-connected

Cutis laxa, X-connected (XLCL) также известен как синдром затылочного рога из-за наличия диагностических двусторонних симметричных клиновидных костных выростов рядом с большим затылочным отверстием на месте трапеции и прикрепление грудино-ключично-сосцевидной мышцы.Может наблюдаться чрезмерная растяжимость запястья и межфаланговых суставов, но могут наблюдаться контрактуры локтя и колена. Черты лица могут включать крючковатый нос и длинный желобок, характерные для кутислакса в целом. Нарушение нормального развития может быть связано с хронической диареей, мальабсорбцией, врожденным гидронефрозом или дивертикулами уретры и мочевого пузыря. 27 Умственная отсталость может присутствовать или отсутствовать. XLCL — это аллель болезни переноса меди с болезнью Менкеса (OMIM № 309400), часто имеющей характерную черту ломкости волос.Церулоплазмин в сыворотке может быть низким или нормальным, а активность лизилоксидазы также может быть снижена.

Ectopia lentis, семейная

Ectopia lentis, семейная вызывается мутациями в FBN1 , которые, как предполагается, нарушают нормальное образование дисульфидных связей и структуру нативного белка. 30 Глаукома может быть вторичной по отношению к подвывиху хрусталика. Хотя мутации в FBN1 приводят к аутосомно-доминантной изолированной эктопии lentis, также описаны аутосомно-рецессивные вариации, некоторые из которых связаны с мутациями в LTBP-2 32 и ADAMTSL4 33 .В трех семьях с аутосомно-рецессивной эктопией lentis из-за мутаций в LTBP-2 наблюдалась остеопения от легкой до умеренной у носителей и пораженных лиц, а также высокое арочное небо, хотя никаких других признаков, совпадающих с синдромом Марфана, не было, тогда как во всех случаях с мутациями LTBP-2 -null в четвертом семействе имел марфаноидные особенности скелета и суставов без остеопении. 32 Ectopia lentis может также возникать в сочетании с легкими скелетными симптомами, пролапсом митрального клапана или непрогрессирующей дилатацией корня аорты, особенно из-за мутаций в FBN1 .У некоторых пациентов с диагнозом семейная эктопия lentis может развиться аневризма аорты в более позднем возрасте, и их можно рассматривать как поздние формы синдрома Марфана. Ectopia lentis также была идентифицирована у подгруппы пациентов с мутациями TGFBR2 и минимальными скелетными изменениями. 34

Синдром Элерса-Данлоса, тип артрохалазии (EDS тип VIIA, VIIB)

Синдром Элерса-Данлоса, тип артрохалазии (EDS тип VIIA, VIIB) отличается от других типов EDS высокой частотой ранних проявлений врожденный вывих бедра, крайняя слабость суставов с периодическими подвывихами суставов (больших и малых, особенно бедер) и минимальное поражение кожи.Гиперэластичность кожи обычно незначительна. Люди с типом EDS артрохалазии могут иметь в анамнезе частые переломы, фенотипическое совпадение с несовершенным остеогенезом, а также низкий рост. 35 Патологической основой этого расстройства является неспособность α-1 или α-2 цепей проколлагена типа I превращаться в коллаген из-за мутаций, изменяющих сайт расщепления проколлагена.

Синдром Элерса-Данлоса, клапанный тип сердца

Синдром Элерса-Данлоса, клапанный тип сердца может иметь типичное поражение кожи и суставов, характерное для классических EDS (хотя и не всегда), а также повышенный риск поражения сердечного клапана.Это очень редкий вариант EDS, на сегодняшний день описано лишь несколько пациентов. Молекулярная основа — полное отсутствие коллагеновых цепей proα2 (I) в результате гомозиготности или гетерозиготности по нулевым мутациям COL1A2 . 36 Сердечно-клапанный EDS является относительно мягким вариантом в спектре клинических фенотипов, возникающих в результате мутаций COL1A2 , который также включает несовершенный остеогенез. В отличие от несовершенного остеогенеза, при EDS сердечного клапана не наблюдается скелетных аномалий.Тип сердечного клапана EDS может перекрываться с легкой формой EDS типа гипермобильности в детстве, с сердечными клапанными осложнениями, возникающими в зрелом возрасте. 37

Синдром Элерса-Данлоса, классический тип (EDS тип I, II)

Синдром Элерса-Данлоса, классический тип (EDS тип I, II) характеризуется кожей, которая часто бывает гладкой и бархатистой. Атрофическое рубцевание — ключевая находка дерматологии. Типичные черты лица могут включать эпикантические складки, избыток кожи век и преждевременный возраст.Он отличается от типа гипермобильности, который имеет гораздо более тонкие кожные проявления. У педиатрических пациентов у детей могут быть синяки. 38 Дефекты коллагена V типа (COL5A1 и COL5A2) выявляются примерно в 50% классических случаев EDS. Основные и второстепенные диагностические особенности шести общепризнанных типов СЭД см. В пересмотренной нозологии, созданной Национальным фондом Элерса-Данлоса (США) и Группой поддержки Элерса-Данлоса (Великобритания). 39

Синдром Элерса-Данлоса, тип дерматоспараксиса (тип EDS VIIC)

Синдром Элерса-Данлоса, тип дерматоспараксиса (тип EDS VIIC) характеризуется крайней хрупкостью кожи.Пациенты с EDS типа дерматоспараксиса могут демонстрировать отсроченное начало типичного фенотипа, и поэтому младенцы из группы риска могут нуждаться в последующем наблюдении в течение первых 2 лет. Дисморфизм лица может включать полноту век, эпикантальные складки и наклонные вниз глазные щели. Могут наблюдаться голубые склеры. В молочных и постоянных зубах может быть множество аномалий. 40 Подобно типу артрохалазии EDS, тип дерматоспараксиса вызывается недостаточностью переработки проколлагена в коллаген.Хотя тип артрохалазии EDS вызывается мутациями в COL1A1 или COL1A2, тип дерматоспораксиса включает мутации в гене протеазы ADAMTS-2. 41

Синдром Элерса-Данлоса, кифосколиотический тип (EDS тип VI)

Синдром Элерса-Данлоса, кифосколиотический тип (EDS тип VI) отличается от других типов EDS большой задержкой моторного развития в результате мышечной гипотонии в сочетании с суставной гипотонией. вялость. Из-за этих клинических особенностей дифференциальная диагностика младенцев с кифосколиотической EDS может первоначально включать врожденные мышечные дистрофии, врожденные миопатии и заболевания нижних мотонейронов.Подростки с этой формой EDS могут иметь общую мышечную слабость в дополнение к снижению мышечного тонуса при остальной гипотонии. 42 Кифосколиотический EDS следует рассматривать, если результаты нервно-мышечных тестов нормализовались, контрактуры отсутствуют и присутствует марфаноидный габитус. Диагноз кифосколиотической EDS может быть подтвержден биохимически по значительно увеличенному соотношению общего лизилпиридинолина в моче и гидроксилизилпиридинолина. 43,44

Синдром Элерса-Данлоса, прогероидный тип

Синдром Элерса-Данлоса, прогероидный тип — это врожденное нарушение гликозилирования, такое как кутислакса AR типа II. 45 Как следует из названия, этот тип EDS может характеризоваться выраженным прогероидным обликом, а также морщинистостью кожи лица, тонкими вьющимися волосами, скудными бровями и ресницами и наклонными глазными щелями. Также типичны задержка развития и аномалии скелета. Кожа может быть рыхлой, но все же эластичной. В фенотипе кожи виден спектр степени тяжести, которая может быть такой же легкой, как небольшая морщинка на лице и отсутствие заметной дряблости кожи. 46

Синдром Элерса-Данлоса, спондилохейродиспластический тип

Синдром Элерса-Данлоса, спондилохейродиспластический тип (SCD-EDS) характеризуется кожей, которая описывается как гладкая, бархатистая, тонкая, хрупкая и полупрозрачная с атрофической рубцовой бумагой. , как в классической EDS.Кожа на руках и ногах может выглядеть морщинистой и преждевременно стареющей, а пальцы описываются как тонкие и сужающиеся. Небольшие контрактуры суставов и значительная атрофия мышц тенара и гипотенара могут ограничивать мелкую моторику и придают рукам внешний вид, аналогичный таковому при синдроме дефицита Lh4. Задержка роста наступает постнатально. Для этого заболевания характерны выпученные глаза с наклонными вниз глазными щелями и голубоватые склеры. Плоскостопие (pes planus), частое явление при заболеваниях соединительной ткани, также характерно для SCD-EDS.Люди с SCD-EDS могут демонстрировать характерную походку вразвалку и испытывать боли в коленях и бедрах при ходьбе. 47

Синдром Элерса-Данлоса, сосудистый тип (EDS тип IV)

Синдром Элерса-Данлоса, сосудистый тип (EDS тип IV) возникает из-за уменьшения или отсутствия нормального коллагена типа III в средней оболочке крупных эластичных артерий . Это предрасполагает людей к аномалиям в основных кровеносных сосудах и возникающим в результате аневризмам, спонтанному разрыву сосудов, расслоениям и артериовенозным свищам.Люди с сосудистым EDS проявляют крайнюю кровоподтёку. Обычно разрывы полых органов включают кишечник, особенно толстую кишку, и матку, что делает беременность очень рискованной для женщин с сосудистой EDS. Проявления легких, хотя и менее распространены, недавно были зарегистрированы и могут включать рецидивирующее кровохарканье, спонтанный пневмоторакс или образование пузырей и пузырей. Отличительные черты лица могут включать акрогерию, характеризующуюся тонким лицом с выступающими костями; впалые щеки; тонкий, защемленный нос; выпученные глаза; и тонкие губы. 48,49 Гиперэластичность кожи и гипермобильность суставов ограничены в сосудистых EDS. Большинство случаев семейных сосудистых EDS наследуются по аутосомно-доминантному типу, хотя был выявлен случай рецессивно наследуемой сосудистой EDS. 50 Существует значительное фенотипическое перекрытие между сосудистыми EDS и семейными артериальными аневризмами. Важно различать синдром Лойса-Дитца и сосудистый EDS из-за значительно более высокой интраоперационной смертности, связанной с последним. 51

Синдром Элерса-Данлоса, дефицит тенасцина X

Синдром Элерса-Данло, дефицит тенасцина X (TNX) характеризуется гипермобильными суставами, гиперэластичной кожей и очень легкими синяками, но без атрофических рубцов или плохого состояния. заживление ран, наблюдаемое в классической EDS. Другие серьезные медицинские проблемы, возникающие у людей с этим заболеванием, включают тяжелое дивертикулярное кишечное заболевание (например, панколоническое) с разрывом дивертикулов, желудочно-кишечное кровотечение, пролапс прямой кишки, пролапс митрального клапана, требующий замены клапана, и хроническое обструктивное заболевание дыхательных путей.Исследования аномальной нервной проводимости, указывающие на полинейропатию, распространены и значительно чаще встречаются при EDS с дефицитом тенасцина-X по сравнению с другими формами EDS. 52 Хотя это рецессивное состояние, до 2/3 женщин, гетерозиготных по дефициту TNX, могут иметь изолированную гипермобильность суставов. Для пациентов с EDS с дефицитом TNX следует рассмотреть менее инвазивные альтернативы эндоскопии из-за теоретического риска перфорации кишечника. Всем пациентам с СЭД с дефицитом TNX рекомендуется базовое легочное исследование, а курящих пациентов следует настоятельно рекомендовать бросить из-за риска развития ХОБЛ. 53 Делеции смежных генов, включающие как гены тенасцина X, так и гены 21-гидроксилазы, могут привести к врожденной гиперплазии надпочечников с дефицитом тенасцина X. 54,55

Семейная аневризма и / или расслоение грудной клетки

Семейная аневризма и / или расслоение грудной клетки (FTAAD) приводит к наследственному расширению, аневризме и расслоению аорты. 56 Церебральные сосуды также могут поражаться веретенообразными аневризмами или извилистостью. Множественные гены, большинство из которых действуют аутосомно-доминантным образом, вызывают FTAAD, а сцепление с другими локусами указывает на то, что дополнительные гены ждут открытия.Было обнаружено, что сокращение гладкомышечных клеток важно для поддержания структурной целостности грудной / восходящей аорты и мутаций в генах, кодирующих α-актин гладкомышечных клеток ( ACTA2 ) и тяжелую цепь β-миозина ( MYh21 ). ) были идентифицированы как причины FTAAD. 57 Мутации в ACTA2 являются наиболее частой причиной FTAAD и могут быть связаны с livedo reticularis, iris flocculi, PDA и BAV. FTAAD, вызванный мутациями TGBFR, часто включает в себя скелетные проявления заболевания соединительной ткани (например, гипермобильность суставов, плоскую стопу, долихоцефалию или сильно искривленное небо), которые не соответствуют диагностическим критериям конкретного синдрома.Были выявлены различия в клинической картине между людьми с FTAAD из-за TGFBR1 и TGFBR2, включая увеличение заболеваемости раком с TGFBR1 по сравнению с TGFBR2 и лучшую выживаемость женщин с сосудистыми заболеваниями из-за мутации TGFBR1 без гендерных различий, наблюдаемых в TGFBR2. 58 Подробный обзор молекулярных основ FTAAD был опубликован Milewicz et al. 59 в 2008 году.

Синдром ломкой Х-хромосомы

Синдром ломкой Х-хромосомы, также известный как синдром Мартина-Белла, является наиболее частой причиной Х-связанной умственной отсталости.Синдром включает множество клинических признаков нарушения соединительной ткани, а в тканях кожи и сердца людей с синдромом ломкой Х-хромосомы обнаруживаются волокна эластина, которые неравномерно распределены и структурированы. 60,61 Pes planus — частая находка со стороны опорно-двигательного аппарата в дополнение к перечисленным в Таблице 1 (Дополнительный цифровой контент 1, http://links.lww.com/GIM/A111). Черты лица могут быть тонкими; характерное лицо — длинное, с высоким лбом, большой челюстью и выступающим подбородком, а уши характерно большие и низко посаженные.В одном исследовании косоглазие (но не синяя склера) присутствовало примерно у половины больных. 60 У больных могут проявляться черты аутизма. Поведенческие и когнитивные проявления чаще всего включают в себя сочетание плохого зрительного контакта, персеверативной речи, эхолалии, плохой концентрации внимания, гиперактивности и необычных манер рук; Пациент с этим характерным лицом, дряблостью суставов, макроорхизмом, семейной историей умственной отсталости и любыми психиатрическими проявлениями, перечисленными выше, должен быть обследован на предмет синдрома ломкой Х-хромосомы.Женщины-носительницы преждевременной мутации Fragile X подвержены риску преждевременной недостаточности яичников. Премутации также связаны с синдромом тремора и атаксии. 62

Гомоцистинурия

Гомоцистинурия возникает из-за дефицита цистатионин-бета-синтазы (CBS). Существует высокий риск заболеваемости и смертности из-за тромбоза сосудов и инсульта. 63 Клинические ключи к диагнозу включают генерализованную гипопигментацию, панкреатит, малярный прилив и ретикулярную ливедо.При гомоцистинурии подвывих хрусталика обычно направлен вниз, тогда как при синдроме Марфана хрусталик обычно смещен вверх. Психоневрологические заболевания часто встречаются у нелеченных пациентов.

Синдром дефицита Lh4

Синдром дефицита Lh4 может проявляться характерной чертой мелких глазниц, маленьким носом, загнутыми вниз уголками рта, плоским профилем лица и низко посаженными упрощенными ушами. Могут присутствовать остеопения и переломы, а задержка роста бывает как внутриутробной, так и послеродовой.В дополнение к характеристикам, перечисленным в Таблице 2 (Дополнительный цифровой контент 2, http://links.lww.com/GIM/A112), присутствовали нерубцовые волдыри на коже, гипопластические ногти, спонтанное кровотечение и катаракта. Выявлен прогрессирующий сколиоз, но не деформации грудной клетки. Косолапость (эквиноварусная косолапость), контрактуры мелких суставов и атрофия мышц тенара и гипотенара похожи на спондилохейродиспластическую форму EDS. Считается, что клинические признаки дефицита Lh4 (лизилгидроксилазы 3) связаны с потерей глюкозилтрансферазной активности Lh4, которая обычно модифицирует пиридинолиновые сшивки коллагена внеклеточно посредством гликозилирования гидроксилизина.Таким образом, отсутствие дисахаридного производного пиридинолина (Glc-Gal-PYD) в моче является биохимически диагностическим, но еще не доступно клинически. 64

Синдром Лойса-Дитца

Синдром Лойса-Дитца имеет континуум проявлений, которые обычно включают как сосудистые, так и скелетные признаки и делятся на два типа на основе третьей основной задействованной системы. Черепно-лицевые находки особенно заметны у LDS типа I, на долю которого приходится около трех четвертей LDS.Кожные изменения наблюдаются у четверти пациентов с LDS II. Эти особенности разрыва органа и сосудистых событий аналогичны тем, которые наблюдаются при EDS сосудов. Как и в классической EDS, в LDS II кожа может быть описана как полупрозрачная и бархатистая. Корреляция генотип-фенотип не объясняет различия между LDS I и LDS II. мутации TGFBR1 составляют 25% пациентов с LDS, а мутации TGFBR2 составляют 75% пациентов с LDS без корреляции с типом. 65 При обоих типах LDS сосудистые проявления имеют тенденцию быть более серьезными, чем при синдроме Марфана, и требуют более тщательного обследования и лечения. Пневмоторакс является основным легочным проявлением синдрома Лойса-Дитца. Органы, включая селезенку, кишечник и матку, подвержены риску разрыва. Грыжи часто повторяются. Помимо эктазии твердой мозговой оболочки нейрорадиологические исследования могут включать проявление типа I по Арнольду-Киари, но это может быть относительно редко. У меньшинства пациентов с LDS будет задержка в развитии.

Синдром Лухана

Синдром Лухана также известен как синдром Лужана-Фринса. Психиатрические проявления могут включать сочетание гиперактивности, эмоциональной лабильности, застенчивости, агрессивности, аутичных манер и психозов. 66 Основным структурным дефектом головного мозга является некоторая агенезия мозолистого тела. Характерные черты синдрома Лухана — длинные и тонкие, с высоким лбом, коротким желобком и иногда микрогнатиями. Другие отличительные особенности, не упомянутые в таблице 2, включают гиперназальный голос и макроцефалию.Для получения дополнительной информации о дифференциальной диагностике синдрома Лухана см. Van Buggenhout and Fryns 67 и Staholpu et al. 68 Синдром FG типа 1, также известный как синдром Опица-Каведжиа типа 1, является аллельным по отношению к синдрому Лухана 69 и имеет много общих клинических признаков, но ни одной из них не является марфаноидной. Анальные аномалии или запоры ограничиваются синдромом ФГ, а высокий рост, длинные руки и пальцы и гиперназальная речь, возникающая из-за высокого носового корня, более характерны для ЛС. 70 Синдром Лухана и синдром FG вызваны мутациями в MED12 . Мутации в UPF3B также были идентифицированы в семьях с фенотипом Lujan-Fryns и фенотипом FG. 71

Синдром MACS (макроцефалия, алопеция, кутислакса и сколиоз)

Синдром MACS (макроцефалия, алопеция, кутислакса и сколиоз) — это недавно описанное наследственное заболевание соединительной ткани, основанное на трех членах двух родственных семей. . 72 Ожидается, что клиническая картина будет развиваться по мере выявления большего числа людей с мутациями RIN2 .Макроцефалия и ретрогнатия являются преобладающими черепными аномалиями. Алопеция относится к редким волосам на коже головы, наблюдаемым при этом заболевании. Cutis laxa наиболее заметна на лице, также может присутствовать ихтиоз легкой степени. Тяжелый сколиоз появляется на втором десятилетии жизни (а не при рождении, как при кифосколиотической EDS), что приводит к низкому росту. Характерные черты лица включают наклонные глазные щели, опухшие веки, обвисшие щеки и вывернутую нижнюю губу. Орто- и пародонтальные проявления включают неправильное положение зубов (неправильно расположенные или непрорезавшиеся) и гиперплазию десен.Кожный фенотип становится более выраженным с возрастом в отличие от ARCLII, при котором кожные проявления со временем ослабевают. Биопсия кожи пораженных лиц выявила дефицит фибулина-5 и уменьшение микрофибрилл кожи. Черты лица напоминают синдром GAPO (задержка роста, псевдоанодонтия, атрофия зрительного нерва) (OMIM № 230740), редкое аутосомно-рецессивное заболевание, которое фенотипически более тяжелое и включает глазные аномалии, а также дерматоспараксисный тип EDS, который также имеет гиперплазию десен, но отличается наличие прозрачной, легко покрывающейся синяками кожи.

Синдром Марфана

Диагноз синдрома Марфана является клиническим диагнозом, основанным на пересмотренных критериях Гентского консенсуса. Для постановки диагноза необходимы основные клинические признаки по крайней мере в двух системах и более легкие или менее специфические клинические признаки в третьей системе. 73 Находки скелета включают высокий рост по сравнению с другими членами семьи (по крайней мере частично из-за непропорционально длинных конечностей), длинные пальцы (арахнодактилия), переднюю деформацию грудной клетки, включая выпячивание (pectus carinatum) или вдавленный вид (pectus excatum) грудины и передние ребра, что связано с разрастанием ребер, слабостью суставов или контрактурами, сколиозом и черепно-лицевыми проявлениями, включая сильно выгнутое небо, скученные зубы и неправильный прикус.Эктазия твердой мозговой оболочки — главный диагностический клинический критерий пояснично-крестцового отдела позвоночника. Офтальмологические находки включают миопию, подвывих хрусталика (ectopia lentis), увеличенную осевую длину глазного яблока и плоскостность роговицы. Сердечно-сосудистые признаки включают пролапс митрального клапана, митральную регургитацию, аортальную регургитацию и дилатацию корня аорты на уровне синусов Вальсальвы, что может привести к аневризме и / или расслоению. Кожные особенности включают стрии и рецидивирующие грыжи.Поражение дыхательных путей может проявляться в виде пузырей в легких, которые предрасполагают к пневмотораксу. Мутации FBN1 наследуются примерно в двух третях случаев и возникают de novo в остальных. Описаны сотни из мутаций FBN1 , и их число продолжает расти. Было установлено немного корреляций генотип-фенотип из-за крайней аллельной гетерогенности в рамках синдрома Марфана и генетически связанных заболеваний. 74–77 Хотя нет известной генетической гетерогенности синдрома Марфана, мутации TGFBR2 также были распознаны у пациентов с марфан-подобными фенотипами.Клинические исходы кажутся аналогичными таковым у пациентов с мутациями FBN1 , причем прогноз в любой группе больше зависит от клинического проявления заболевания и лечения, чем от ответственного гена. Было обнаружено, что пациенты с мутациями FBN1 имели более обширное поражение скелета, тогда как пациенты с мутациями TGFBR2 имели более тяжелые аортальные фенотипы в целом. 34

Фенотип MASS

Фенотип MASS указывает на участие MASS.Расширение аорты пограничное и непрогрессирующее, а кожные и скелетные изменения неспецифичны. Эти клинические характеристики в значительной степени совпадают с характеристиками синдрома Марфана и обеспечивают четкое свидетельство системного дефекта внеклеточного матрикса, но их недостаточно для диагностики синдрома Марфана. Таким образом, фенотип MASS является частью клинического континуума расстройств FBN1 , который варьируется от синдрома Марфана до отдельных признаков, таких как эктопия lentis. 78 Следовательно, трудно отличить фенотип MASS от ранних стадий синдрома Марфана при оценке людей, особенно детей, при отсутствии семейного анамнеза.Поэтому показан периодический сердечно-сосудистый мониторинг.

Синдром пролапса митрального клапана

Синдром пролапса митрального клапана (ПМК) относится к случаям идиопатического ПМК, в которых исключены другие заболевания сердца и соединительной ткани. Синдром ПМК связан с системными признаками, которые могут включать боль в груди, одышку, деформацию грудной клетки (включая узкий диаметр А-П), аритмию, легкую слабость суставов и длинные конечности. Пролапс возникает, когда створки митрального клапана поднимаются в левое предсердие и, по оценкам, присутствуют в 2.4% от общей популяции, демонстрирующие пенетрантность в зависимости от возраста и пола. 79 MVP может быть спорадическим или семейным, изолированным или быть частью синдрома. 80 На сегодняшний день не описано никаких специфических генов для MVP, хотя были идентифицированы три аутосомных и один X-сцепленный локусы. Прогноз при синдроме ПМК лучше, чем при ПМК при синдроме Марфана, со значительно меньшим риском митральной регургитации.

Стойкий открытый артериоз протока с семейной аневризмой грудной клетки

Стойкий открытый артериоз протока с семейной аневризмой грудной клетки (ОАП с FTA) является моногенным патофизиологическим субъектом в гетерогенной группе заболеваний TAA.Это вызвано мутациями в специфической области гена тяжелой цепи миозина MYh21 гладкомышечных клеток, которые связаны с выраженной жесткостью аорты даже у бессимптомных лиц с гаплотипом заболевания. 81–83 Риск у пациентов с КПК с FTA можно оценить с помощью неинвазивного измерения эластичности и растяжимости аорты с помощью МРТ. FTA без КПК также вызывается мутациями MYh21 . MYh21 редко участвует в спорадически изолированном PDA. 84

Синдром Шпринцена-Гольдберга

Синдром Шпринцена-Гольдберга (SGS) имеет много общих клинических проявлений с MFS и LDS, что позволяет предположить, что SGS также может действовать через нарушение сигнальных путей TGF-β, хотя уникальных генетических локусов еще не было. учредил. Идентификация мутаций TGFBR1 , TGFBR2 и FBN1 у некоторых пациентов с диагнозом SGS предполагает, что признание SGS как отдельного патогенетического объекта может быть неуместным, хотя проблема остается спорной. 85–87 Характерные черты лица SGS могут включать гипертелоризм, наклонные вниз глазные щели, сильно выгнутое небо, микрогнатию, проптоз (выступающие глаза) и низко посаженные, повернутые назад уши. 88 Наличие этой характерной черты лица, краниосиностоз и умственная отсталость являются основными признаками, используемыми для клинического отличия SGS. Другие особенности включают аномалию Киари, аномалии ребер и эквиноварусную деформацию (косолапость). SGS отличается от синдрома Гольдберга-Шпринцена (OMIM no.609640) и синдром Шпринцена (OMIM № 192430).

Синдром Снайдера-Робинсона

Синдром Снайдера-Робинсона — это редкий Х-сцепленный синдром умственной отсталости с марфаноидными особенностями скелета, сходными с синдромом Лухана. Другие характерные черты этого синдрома включают асимметрию лица с выступающей нижней губой, носовой голос, неустойчивую походку, неспецифическое двигательное расстройство, аномалии ЭЭГ, судороги и уменьшение мышечной массы. 89–91

Синдром Стиклера

Синдром Стиклера — относительно частое заболевание соединительной ткани.Катаракта и глаукома могут сопровождать другие глазные находки в Таблице 2 (Дополнительный цифровой контент 2, http://links.lww.com/GIM/A112). Также может присутствовать легкая спондилоэпифизарная дисплазия, а потеря слуха может быть кондуктивной и нейросенсорной. Также часто наблюдаются плоское лицо и увеличенные колени. Наличие некоторых клинических признаков, включая отслоение сетчатки, катаракту, нейросенсорную тугоухость, дегенеративное заболевание суставов с ранним началом и некоторые аномалии скелета, является функцией возраста.Молекулярный анализ может помочь в диагностике расстройства, но не очень полезен для прогнозирования фенотипического проявления заболевания, за исключением глазных проявлений. 92 Клинически распознаются два витреоретинальных фенотипа. 93 Мутации в COL2A1 связаны с «мембранным» фенотипом стекловидного тела 1 типа. Поскольку экзон 2 COL2A1 преимущественно экспрессируется в глазу, мутации в этом экзоне приводят к изолированному дефекту стекловидного тела 1 типа. 94 Менее распространенный фенотип стекловидного тела типа II связан с мутациями в COL11A1 . Мутации в COL11A2 производят фенотип Stickler без проявлений стекловидного тела, потому что COL11A2 не экспрессируется в этой ткани. 95

Синдром Вейля-Марчесани

Синдром Вейля-Марчесани (WMS) демонстрирует значительную клиническую однородность, несмотря на его генетическую гетерогенность. При сравнении аутосомно-доминантного (AD — из-за FBN1 ) и аутосомно-рецессивного (AR — из-за ADAMTS10 ) WMS не было обнаружено значительных различий в частоте большинства клинических признаков. 96 Была примерно 20% разница в частоте случаев микросферофакии и сердечных аномалий между AR и AD WMS (более распространены в AR WMS), а также суставных ограничений и эктопии lentis (более распространенной в AD WMS), 97 хотя эти характеристики обычно встречаются в обеих формах WMS. Еще больше усложняя дифференциацию между AR и AD WMS на основе семейного анамнеза, некоторые гетерозиготы для AR WMS демонстрируют легкие клинические проявления заболевания, включая низкий рост, брахидактилию и патологические результаты гониоскопии.Помимо глазных проявлений, перечисленных в Таблице 2 (Дополнительный цифровой контент 2, http://links.lww.com/GIM/A112), особенностями WMS могут быть мелкие орбиты и глаукома. Врожденные сердечные аномалии, о которых сообщалось у пациентов с WMS, включают MVP, удлиненный интервал QT и стенозы легочного и аортального клапана. Пациентам с WMS и в анамнезе сердцебиение, головокружение, головокружение или обмороки следует обследовать на предмет удлинения интервала QTc, так как это может быть связано с серьезной аритмией. 98 Дифференциальный диагноз WMS включает синдром Хантера-Макдональда. 99

Доказательства 18 424 участников Тайваньского биобанка

Заявление о соблюдении этических норм

TWB получил этическое одобрение от Институционального наблюдательного совета по биомедицинским научным исследованиям / IRB-BM, Academia Sinica, Тайвань, и от Совета по этике и управлению Тайваньского биобанка, Тайвань. Письменное информированное согласие было получено от каждого участника в соответствии с институциональными требованиями и принципами Хельсинкской декларации. Более того, настоящее исследование было одобрено Комитетом по этике исследований Национальной университетской больницы Тайваня (NTUH-REC no.201805050РИНБ).

Тайвань Биобанк

Тайваньский биобанк (TWB) — крупнейший поддерживаемый государством биобанк на Тайване. Целью TWB является сбор данных об образе жизни и геноме жителей Тайваня [25, 26]. TWB продолжает набор добровольцев из местных сообществ в возрасте от 30 до 70 лет, не страдающих онкологическими заболеваниями. Участники подписали информированное согласие, предоставили образцы крови и различную информацию в ходе личного интервью и медицинского осмотра. В нашем исследовании приняли участие 20287 человек с TWB, которым до октября 2018 года был проведен полногеномный генотип.Чтобы устранить загадочное родство, мы оценили полногеномную идентичность по коэффициентам распределения по происхождению (IBD) между любыми двумя субъектами. Показатели IBD для всех пар субъектов, т. Е. PI-HAT = вероятность (IBD = 2) + 0,5 × вероятность (IBD = 1), были получены из PLINK 1.9 [27]. Как и во многих генетических исследованиях [28–30], мы исключили родственников третьей степени родства, удалив одного человека из пары с PI-HAT ≥ 0,125. После этого этапа в нашем анализе остались 18 424 неродственных субъекта (9 093 мужчины и 9 331 женщина).

Большинство субъектов TWB имели китайское происхождение [25]. Чип TWB основан на системе Axiom Genome-Wide Array Plate System (Affymetrix, Санта-Клара, Калифорния, США). Он генотипировал в общей сложности 646 783 аутосомных однонуклеотидных полиморфизма (SNP). Мы исключили 51 293 SNP с частотой генотипирования <95%, 6095 SNP с тестом Харди-Вайнберга P -значения <5,7 × 10 −7 [31] и 1869 вариантов с частотами минорных аллелей (MAF) <1%. Остальные 587 526 SNP были использованы для построения основных компонентов предков (PC) для корректировки стратификации населения.

TWB измерил рост и вес каждого участника. ИМТ рассчитывали по весу (кг) / [росту (м)] 2 . Помимо ИМТ, также были исследованы 4 показателя, включая BFP, WC, HC и WHR. BFP — это процент веса человека, состоящий из жира. WHR — это отношение WC к HC и обычно используется для определения центрального ожирения [8].

В дополнение к физическому обследованию каждый участник заполнил анкету посредством личного интервью с одним из исследователей TWB.Вопросы касались личной информации и факторов образа жизни. Регулярные упражнения были определены как «упражнения» по 30 минут три раза в неделю. «Упражнения» включали только занятия в свободное время, такие как бег трусцой, йога, альпинизм, езда на велосипеде, плавание, революция танцевальных танцев (DDR, компьютерная игра, основанная на танцах с музыкальными клипами), игра в баскетбол и т. Д. Профессиональная деятельность, такая как физическая работа тяжелый физический труд не считался «упражнением».

Ковариаты скорректированы во всех моделях

Пол и возраст (в годах) рассматривались как важные коварианты в большинстве исследований ожирения [13–16, 18, 20, 24, 32–34].Более того, некоторые исследования также скорректированы на алкогольный статус, статус курения и уровень образования [16]. Предыдущее крупномасштабное исследование обнаружило обратную связь между ИМТ, а также WC и уровнем образования [35]. Поэтому мы также рассматривали уровень образования как одну из ковариат для оценки ожирения. Уровень образования регистрировался как значение от 1 до 7, где 1 означало «неграмотный», 2 означало «без формального образования, но грамотное», 3 представляло «выпускник начальной школы», 4 означало «выпускник неполной средней школы», 5 означало « выпускник старшей школы », 6 -« выпускник колледжа », а 7 -« степень магистра или выше ».

Употребление алкоголя определялось как субъект, который еженедельно потреблял более 150 см3 алкоголя в течение не менее 6 месяцев и не прекращал пить во время оценки его / ее показателей ожирения. Курение определялось как субъект, который курил не менее 6 месяцев и не бросил курить в то время, когда оценивались его / ее показатели ожирения.

Шкала генетического риска (GRS) для пяти показателей ожирения

В большинстве исследований взаимодействия генов с окружающей средой (G × E) исследователи обычно строили GRS и проверяли значимость члена взаимодействия GRS × E (E представляет фактор окружающей среды) [13–24].GRS представлял собой взвешенную сумму количества аллелей риска, где веса обычно извлекались из крупных опубликованных исследований общегеномных ассоциаций (GWAS) или метаанализов [13–24]. Недавние исследования G × E, связанные с показателями ожирения [14, 16–19, 21, 23], обычно строили GRS в соответствии с результатами большого метаанализа [34], в котором 97 связанных с ИМТ SNP достигают общегеномного уровня. уровень значимости ( p <5 × 10 -8 ) не сообщалось [34].

Всего 20 из 97 SNP были генотипированы в чипе TWB.Мы вменяли генотипы других SNP с помощью Michigan Imputation Server (https://imputationserver.sph.umich.edu/index.html) с эталонной панелью, основанной на популяции Восточной Азии (EAS) из 1000 Genomes Phase 3 v5. . После удаления SNP с MAF <1% и SNP с тестом Харди-Вайнберга -значения P <5,7 × 10 −7 [31], 86 SNP остались в таблице S1. GRS для Европы рассчитывался как, где веса ( w j , j = 1, ⋯, 86) были величинами эффекта, о которых сообщал Локк и др. .[34], а SNP j — количество аллелей эффекта в SNP j th . Затем каждый EuGRS был преобразован в оценку z , которая показывала, сколько стандартных отклонений EuGRS было от среднего. Хотя EuGRS положительно связан с 5 показателями ожирения (таблица S2) (результаты взаимодействий EuGRS × упражнения можно найти в таблицах S3 – S5), он может быть неэффективным GRS для обнаружения TWB G × E по следующим трем причинам. .

Во-первых, 97 SNP объясняют 2,70% вариации ИМТ у европейцев [34]. Однако у субъектов TWB эти SNP могут объяснить только 1,92%, 1,05%, 1,43%, 1,60% и 0,79% вариации ИМТ, BFP, WC, HC и WHR, соответственно (таблица S6). Во-вторых, все 97 связанных с ИМТ SNP достигли уровня значимости для всего генома ( p <5 × 10 -8 ) у европейцев. Однако в TWB только rs1558902 , локализованные в жировой массе и связанном с ожирением ( FTO ) гене, были связаны с ИМТ на уровне значимости для всего генома, и только 29 были связаны с ИМТ на уровне значимости 0.05 (Таблица S1). В-третьих, ни один из 97 связанных с ИМТ SNP не был связан с другими 4 показателями ожирения на уровне значимости для всего генома (таблица S1). ИМТ — это наиболее часто исследуемый показатель ожирения. О SNP, устойчиво связанных с другими показателями ожирения, не сообщалось.

По указанным выше трем причинам использование EuGRS может быть неэффективным для китайцев хань и других показателей ожирения, кроме ИМТ. Однако большие GWAS, связанные с ожирением, в ханьском китайском языке недоступны. Чтобы преодолеть эту проблему, мы использовали внутренние веса для построения GRS, а затем протестировали член взаимодействия GRS × E в регрессионной модели.Этот подход был предложен в исследованиях G × E на основе всего генома [36], путей [37, 38] и генов [39, 40].

Первоначально SNP в высоком неравновесном сцеплении (LD) были сначала обрезаны, чтобы избежать мультиколлинеарности [41, 42]. Мы использовали команду PLINK 1.9 «plink — bfile TWBGWAS — chr 1–22 — indep 50 5 2» для сокращения SNP в высоких LD [27]. Таким образом, мы удалили SNP с коэффициентом увеличения дисперсии> 2 в скользящем окне размером 50, где скользящее окно сдвигалось на каждом шаге 5 SNP.После этого этапа обрезки осталось 142 040 SNP. Затем мы регрессировали ИМТ по каждому из 142 040 SNP с поправкой на ковариаты, включая пол, возраст, уровень образования, статус употребления алкоголя, статус курения и первые 10 ПК. 142040 регрессионных моделей были построены следующим образом: (1) где SNP i — количество минорных аллелей в SNP i th (0, 1 или 2), а ε — член ошибки. По результатам тестирования H 0 : β SNP , i = 0 vs . H 1 : β SNP , i ≠ 0, мы получили значение P , касающееся предельной связи SNP i th с ИМТ.

Рассматривая модель, включающую взаимодействия SNP по окружающей среде, как показано ниже: (2) (оценка по модели 1) и (оценка по модели 2) асимптотически независимы при нулевой гипотезе об отсутствии взаимодействия SNP с окружающей средой (доказанной в следствии 1 из [43]).Двухэтапный подход, который сначала фильтрует SNP по критерию, не зависящему от тестовой статистики (оцененной по модели 2) при нулевой гипотезе, а затем использует только те SNP, которые проходят фильтр, может поддерживать частоту ошибок типа I и повышать мощность [44, 45].

При заданном пороговом значении P (фильтр) 142 040 SNP были распределены в набор, связанный с ИМТ, и набор, не связанный с ИМТ, в соответствии с их значениями маргинальной ассоциации P . Предположим, что существует m SNP, связанных с ИМТ, оценка генетического риска ИМТ (BMIGRS) была рассчитана как, где веса () были оценены из модели (1), а SNP j было числом минорные аллели в SNP j th в наборе, ассоциированном с ИМТ.

Поскольку SNP, не ассоциированные с BMI, были отфильтрованы при построении BMIGRS, этот подход представляет собой так называемую «фильтрацию маргинальной ассоциации» в анализе G × E [40, 43, 45]. Следуя предложению из нашего предыдущего методологического исследования [36], были рассмотрены 10 порогов значений P : 0,0001, 0,00025, 0,0005, 0,001, 0,0025, 0,005, 0,01, 0,025, 0,05 и 0,1. В таблице S7 показано количество SNP в наборах, связанных с BMI, при пороговых значениях 10 P . Для каждого субъекта TWB были рассчитаны 10 BMIGRS на основе 10 наборов SNP.Например, 9 BMIGRS накопил информацию о 7 753 SNP (таблица S7).

Аналогично модели (1), BFP, WC, HC и WHR регрессировали для каждого из 142 040 SNP с поправкой на те же ковариаты, соответственно. Всего было получено 10 BFPGRS, 10 WCGRS, 10 HCGRS и 10 WHRGRS при пороговых значениях 10 P . Затем каждый GRS был преобразован в оценку z , которая показывала, сколько стандартных отклонений GRS было от среднего.Количество SNP для формирования каждого GRS было указано в таблице S7.

Подход GRS, основанный на предельных эффектах SNP (GRS-M)

Мы исследовали, можно ли изменить связь BMIGRS с ИМТ с помощью регулярных физических упражнений (да или нет). ИМТ регрессировал на BMIGRS, регулярные упражнения или нет (E: 1 против 0) и взаимодействие между ними (BMIGRS × E), с поправкой на пол, возраст, уровень образования, статус употребления алкоголя, статус курения и первое. 10 шт. Модель регрессии была построена следующим образом: (3)

С 10 BMIGRS были подобраны 10 регрессионных моделей, таких как (3), и 10 P -значений, касающихся тестирования H 0 : β Int = 0 vs . H 1 : β Int ≠ 0. Чтобы приспособиться к множественному тестированию, скорректированное Бонферрони значение P было рассчитано как 10-кратное минимальное значение P из 10 тестов взаимодействия BMIGRS × E. Этот подход получил название «подход GRS, основанный на предельных эффектах SNP», сокращенно метод «GRS-M» [36]. Комплексное моделирование, выполненное Hüls et al . [37, 38] и Лин и др. .[36] подтвердили правомерность построения GRS с предельными эффектами SNP при обнаружении G × E. Извлечение весов из других когорт или разделение данных на два подмножества не требуется для подхода GRS-M [36]. Подход GRS-M действителен в том смысле, что уровень ошибок эмпирического типа I. Более того, это обычно самый мощный тест, если некоторые связанные с фенотипом SNP также обнаруживают взаимодействия с E [36].

Точно так же мы исследовали взаимодействие GRS и упражнений с другими 4 показателями ожирения.Уровень значимости в этой работе был установлен на 0,05 / 550 = 9,1×10 -5 , потому что было выполнено 275 тестов на взаимодействие GRS-упражнения и 275 тестов на основные эффекты упражнений.

Hemojuvelin — обзор | ScienceDirect Topics

Hemojuvelin

Хотя мутации в гемоювелине, связанные с ювенильным гемохроматозом, встречаются редко, они встречаются чаще, чем мутации в гепсидине, другом гене, ассоциированном с ювенильным гемохроматозом. Существует несколько более распространенных мутаций геможувелина, особенно G320V, I222N и C80R, но также встречаются частные мутации.Методы прямого секвенирования, dHPLC, RFLP и ASOH были описаны для генетического анализа мутаций гемодювелина.

Для прямого секвенирования амплификацию ДНК гена гемодувелина проводят с использованием праймеров, описанных в таблице 16.3. Область непосредственного промотора и экзон 1 амплифицируются как один фрагмент, экзон 2 и 3 амплифицируются отдельно, а экзон 4 разделяется на два перекрывающихся продукта амплификации. Амплификацию проводят после начальной стадии денатурации 96 ° C в течение 5 минут, 95 ° C в течение 1 минуты, 61 ° C в течение 30 секунд и 72 ° C в течение 1 минуты в течение 30 циклов.После очистки продуктов амплификации ДНК выполняется прямое секвенирование с использованием исходных праймеров для амплификации.

Таблица 16.3. Праймеры и условия для ПЦР Hemojuvelin и dHPLC

907 AGTAGGCAGTGACCACAGAGT 67vAC GCA Ex 3GCC GCA 47 1131 → 1112
PCR
Hemojuvelin Последовательность праймеров Положение Размер (п.о.) Temp (° C)
-281 → -261 * 523 61
Hjv Ex 1R CGAGAGACATCCAAGTAGGTGT Ivs1 + 93 → ivs1 + 72
Hjv Пример 2F ATCTCCCCAAATTCCAGTCTG Ivs1 — 119 → ivs1 −99 359 61
Hjv Ex 2R ACATAGCAGCCTACCCTCTAG Ivs2 + 54 → ivs2 + 34
GCCC
669 61
Hjv Ex 3R GAATCTCATGAGGTGGATCGG Ivs3 + 42 → ivs3 + 2 2
Hjv Ex 4AF TAGTCCTGCATCTCTACTTGG Ivs3 — 107 → ivs3 — 87 581 61
HJVGC
Hjv Ex 4CF GCTCTCCTTCTCCATCAAGG c.879 → 898 774 61
TAAG7 TA750 61
TA749 TAGTC7 → 4DRGTT

Несколько лабораторий идентифицировали мутации в геможувелине с помощью dHPLC. Сканирование на предмет новых мутаций и обнаружение известных мутаций в геможувелине требует, чтобы фрагменты ДНК были меньше, чем требуется для прямого секвенирования.Следовательно, необходимы дополнительные праймеры для амплификации меньших фрагментов ДНК. Были описаны праймеры и условия для dHPLC (Lee et al., 2004; Biasiotto et al., 2004).

RFLP-анализ использовался для обнаружения мутаций гемодювелина I222N (c.665T → A) и G320V (c. 959G → T) (Barton et al., 2004). Амплификацию экзона 4 проводят с праймерами Hjv 4AF и 4BR. Рестрикционный фермент BccI переваривает фрагмент, когда присутствует нуклеотид c.665T I222, но не, если присутствует c.665A (N222).Электрофоретическое разделение и обнаружение нерасщепленного фрагмента BccI длиной 581 п.о. или двух переваренных фрагментов BccI (120 п.о. и 461 п.о.) с использованием геля 8% полиакриламида / 1/2 × TBE позволяет установить генотип. Точно так же эндонуклеаза рестрикции BanI расщепляет фрагмент ДНК, содержащий c.959G (G320), но не аллель c.959T (V320). Генотип определяют путем разделения и обнаружения непереваренного фрагмента BanI длиной 581 п.о. или двух переваренных фрагментов BanI (409 и 172 п.о.) с помощью электрофореза в полиакриламидном геле.

Были описаны праймеры и условия для выполнения ASOH на полиморфизмах геможувелина G55G, insG69, Ser264, Ile275, A310G и нескольких интронных полиморфизмах (Lee et al., 2004).

Связанные генетические варианты на хромосоме 10 контролируют морфологию ушей и массу тела собак | BMC Genomics

Межпородный GWAS определяет интервал на хромосоме 10

Сначала мы проверили ассоциации с массой тела и типом ушей, используя набор из 509 образцов от 46 пород (таблица 1), типизированных с использованием массива SNP canineHD (~ 174000 SNP) .Мы выполнили GWAS для типа уха, сравнивая 20 пород с висячим ухом ( n = 242), 12 пород с колючим ухом ( n = 108) и 14 пород среднего уха ( n = 159). Мы оценили общегеномную значимость, используя процедуру перестановки пород, использованную в исх. [12]. Этот метод точно определяет коррекцию значимости для разных размеров выборки каждой породы. Всего 24 SNP достигают полногеномного значения. Из них 23 находятся между 9,9 и 11,8 МБ на CFA10 (рис. 1a, b), а остальные — на CFA1 (дополнительный файл 1: таблица S1).SNP с наиболее сильной ассоциацией с типом уха расположен в CFA10: 11 072 007 (p raw = 7,5 × 10 −92 , p для всего генома <0,001), который находится между MSRB3 и HMGA2 . гены (все координаты приведены на сборке canFam2.0).

Таблица 1 Образцы, использованные в GWAS с фенотипами уха и массы тела Рис. 1

Генетические ассоциации с типом уха и массой тела у пород собак. Манхэттенский график , показывающий необработанное значение p ассоциации с типом уха (верхняя панель) и массой тела (нижняя панель) среди пород собак по ~ 174 000 SNP.Наиболее значимые ассоциации с типом уха обнаруживаются в области 9,5–12,5 Мб на CFA10. Наиболее значимая связь с массой тела обнаруживается на CFA15, близком к гену IGF1 . Область CFA10, связанная с типом уха, является второй наиболее тесно связанной с массой тела областью. b Расширенный вид области CFA10, показывающий связь с типом уха (верхняя панель) и массой тела (нижняя панель). c Значимость ассоциации между частотой аллелей и типом ушей (верхняя панель) и массой тела (нижняя панель) для 123 кандидатных SNP в области ~ 2 Mb на CFA10 в 288 образцах от 46 пород. d Положение человеческих генов RefSeq, картированных на ссылку canFam2.0. Гены помечены +/- в соответствии с направлением транскрипции

Затем мы изучили связь с массой тела, измеряемой в килограммах, используя среднюю массу для каждой породы (таблица 1), используя количественное исследование ассоциации всех 46 пород. Мы идентифицировали 8 SNP со значимостью для всего генома на CFA15 в узкой области 44,22 — 44,28 Mb. Наиболее ассоциированный SNP находится в CFA15: 44 231 500 (p raw = 4.3 × 10 −65 , p на весь геном = 0,001). Эти SNP перекрывают локус IGF1 , ранее участвовавший в вариациях массы тела среди пород собак [20]. Однако в области CFA10 наблюдается вторичный пик, также связанный с типом уха. Один SNP в этой области достигает общегеномной значимости (CFA10: 11,169,956, p raw = 8,2 × 10 -45 , p в ширину генома = 0,033), что находится между MSRB3 и HMGA2 (рис.1а, б, Дополнительный файл 1: Таблица S1).

В нашем наборе данных нет существенной разницы в средней массе тела между породами с разными типами ушей (хи-квадрат Краскела-Уоллиса = 0,224, p = 0,89). Средняя масса тела висячих, остроухих и средних ушей составляет 25,2 кг, 22,9 кг и 23,1 кг соответственно. Это указывает на то, что ассоциации между массой тела и типом уха в области CFA10 не зависят друг от друга. Мы также выполнили GWAS для массы тела в каждой из трех категорий типа уха (падение, укол, средний уровень).Среди 12 пород с острым ухом наблюдалась сильная значимая связь по всему геному с массой тела на CFA15 рядом с геном IGF1 (44 231 500, 44 267 011, 44 226 659, p для всего генома <0,001), но сигналы в области CFA10 были отменены, без каких-либо наводящих сигналов (дополнительный файл 2: рисунок S1). Среди 20 пород с висячими ушами не было значительной ассоциации в геноме, включая области CFA15 и CFA10. Однако среди 14 пород с переменным или промежуточным типом ушей самый сильный сигнал был замечен в области CFA10, с наибольшей значимостью около SNP, идентифицированного ранее для всех пород (CFA10: 11,169,556; p для всего генома = 0.097; Дополнительный файл 2: Рисунок S1, Дополнительный файл 1: Таблица S1). Эти результаты подтверждают, что генетическая связь с массой тела не зависит от типа уха. Отсутствие ассоциации с регионом CFA10 у пород с остроконечными и висячими ушами, вероятно, связано с небольшим количеством очень мелких пород с остроконечными или висячими ушами в этом наборе данных (Таблица 1).

Помимо корреляций с морфологией, предыдущие исследования идентифицировали этот регион CFA10 как один из наиболее дифференцированных среди пород [12, 13].В том же наборе данных из 46 пород область 2,0 Mb (CFA10: 9,8 — 11,8 Mb) содержит 33 SNP с F ST > 0,55 и частотой минорных аллелей> 15%, что представляет собой второй по длине такой участок SNP с высоким F ST в геноме. SNP с наивысшим значением F ST в этом регионе: CFA10: 11 169 956 (F ST = 0,81), что сильно связано с массой тела, а CFA10: 11 000 274 ​​(F ST = 0,77) тесно связано с типом уха. (см. выше).Крайняя дифференциация популяции в этом регионе свидетельствует о сильном искусственном отборе.

Анализ вариации последовательности в 3 Mb, охватывающий критический интервал

Приведенные выше данные свидетельствуют о том, что критическая область на CFA10 содержит генетические варианты, ответственные за тип уха и массу тела, и прошла отбор в связи с созданием и поддержанием различных пород собак. Поэтому мы решили проанализировать вариацию последовательности в интервале 3 МБ, охватывающем эту область (CFA10: 9.5 Mb — 12,5 Mb) в породах с различными фенотипами, чтобы идентифицировать генетические варианты-кандидаты, которые контролируют эту вариацию. Эта область была выбрана для охвата высокодифференцированного интервала 1-2 Мб, определяемого F . СТ идентифицировано ссылками [12, 13]. Используя захват последовательности с последующим секвенированием полосы Illumina Hi-Seq для каждой библиотеки, мы секвенировали этот интервал в 5 пулах собак, каждый из которых содержал 5 образцов одной породы, что привело к среднему охвату 4227x.Мы выбрали породы с висячими или не висячими ушами, которые были зафиксированы для соответствующих аллелей ассоциированных SNP в анализах GWAS, и сегрегация ассоциированных маркеров, представленная в ссылке. [21]. Сюда входили две маленькие породы с не висячими ушами (бордер терьер, джек-рассел терьер), одна крупная порода с не висячими ушами (немецкая овчарка) и две большие породы с висячими ушами (веймеранер, английский спрингер-спаниель; таблица 2). . Ожидается, что две маленькие породы будут иметь вариант с малой массой в соответствии с результатами GWAS, представленными выше, и сегрегацией ассоциированных маркеров, представленной в исх.[21]. Мы называем это набором данных захвата последовательности (SC).

Таблица 2 Образцы, использованные в исследованиях повторного секвенирования с количеством SNP, идентифицированных с использованием строгого отсечения (99%)

Мы определили общие SNP в наборе данных SC на основе отсечки частоты минорных аллелей> 0,1, а затем вывели частоту каждого SNP в каждом пуле во всех выборках на основе доли считываний, соответствующих каждому аллелю (см. Методы). Используя этот подход, мы идентифицировали 5 181 переменный SNP в данных SC.Затем каждый SNP был классифицирован как фиксированный для референсного аллеля, фиксированный для нереференсного аллеля, полиморфный или неинформативный в каждом пуле (рис.2, таблица 2, дополнительный файл 3: таблица S2) с использованием выбора как строгих, так и свободных пороговых значений для определения фиксация. Из этих SNP мы определили кандидатов, которые были разделены по фенотипу массы тела или ушей. Чтобы SNP считался кандидатом, необходимо было, чтобы все пулы, представляющие определенный фенотип, были зафиксированы для одного и того же аллеля.Всего по данным SC было идентифицировано 83 кандидата по типу уха и 87 кандидатов по массе тела.

Рис. 2

Паттерны вариации SNP в области 3 Мб на CFA10. Первые 5 столбцов показывают вариации пулов захвата последовательности (SC) отдельных пород, а следующие 6 столбцов показывают вариации пулов секвенирования всего генома (WGS; подробности см. В таблице 2). Красные линии представляют позиции SNP, которые зафиксированы для нереференсного аллеля в конкретном пуле, серые линии представляют позиции SNP, которые нельзя уверенно оценить из-за низкого охвата.Сайты, полиморфные в пределах породы или соответствующие эталонному аллелю, не помечаются. Три нижних столбца представляют собой SNP, которые отображают паттерны фиксации, соответствующие фенотипической изменчивости. Показаны SNP-кандидаты для контроля вариации массы тела (синий), тип уха (зеленый) и те, которые зафиксированы для альтернативных аллелей у всех собак по сравнению с волками (фиолетовый). Также показано расположение генов, кодирующих белок в этой области, которые были идентифицированы путем картирования человеческих генов RefSeq на canFam2.0 собачья сборка. Гены помечены +/- в соответствии с направлением транскрипции. Кандидаты в массу ушей и тела сконцентрированы в области между генами MSRB3 и HMGA2 , тогда как кластер фиксации собака-волк обнаружен в гене MSRB3

Затем мы сравнили паттерны вариации в SNP, идентифицированных в последовательностях захвата последовательности, с считыванием из полногеномного секвенирования (WGS), сопоставленным с той же областью в 5 пулах образцов собак от одной или нескольких пород, и одном пуле образцов волков, представленном Аксельссоном. et al. [10]. Все собачьи пулы состояли из крупных пород. Две из этих групп собак содержали только породы с висячими ушами, одна содержала породу с одним острым ухом, а две — породы со смесью типов ушей (Таблица 2). Считалось, что волчья стая имеют большую массу тела и фенотип колючего уха. Только позиции, которые были вариабельными в пулах захвата последовательностей, рассматривались в пулах WGS, которые также определялись как фиксированные для референсного аллеля, фиксированные для нереференсного аллеля, полиморфные или неинформативные.

Мы использовали паттерны сегрегации в пулах WGS, чтобы исключить кандидатные SNP из пулов SC, которые показали паттерны сегрегации, несовместимые с фенотипом. Кандидаты SNP были отфильтрованы, если аллели, соответствующие неправильному фенотипу на основе данных SC, наблюдались в любом пуле WGS (полный набор SNP см. В дополнительном файле 3: Таблица S2). Остальные SNP-кандидаты в основном сконцентрированы в области 500 т.п.н. между 11,0 и 11,5 млн п.о., которая находится ниже гена MSRB3 и охватывает ген HMGA2 .Кластер из семи кандидатных SNP для типа уха обнаруживается сразу после гена MSRB3 между 11,0 и 11,1 Mb (рис. 2).

Мы провели анализ, основанный на глубине считывания, чтобы идентифицировать предполагаемые варианты числа копий (CNV), которые связаны с фенотипом, но не выявили таких случаев. Мы использовали данные SC для сканирования ассоциированной области размером 500 т.п.н. и фланкирующей последовательности с использованием окон размером 100 п.о., чтобы определить асимметричную глубину чтения между пулами, которая может возникнуть в результате изменения количества копий (дополнительный файл 4: рисунок S2).Мы проверили совокупность считываний около 28 регионов с более чем двукратным разбросом по глубине чтения или в которых один или несколько пулов не были охвачены с помощью интегративного средства просмотра генома (IGV). Из них 22 области сопоставлены с повторяющимися элементами, включая две, которые сопоставлены с простыми повторами, и 20, которые сопоставлены с элементами LINE / SINE (дополнительный файл 5: таблица S3). Хотя некоторые из них могут представлять собой истинные CNV, связанные с присутствием / отсутствием повторяющихся элементов, шаблоны согласуются с плохо сопоставленными считываниями. Из всех регионов только 5 имеют некоторую степень сохранения, и ни один из них не демонстрирует паттерны относительного охвата считыванием, согласующиеся с корреляцией либо с фенотипом уха, либо с фенотипом массы тела.Следовательно, среди этих регионов нет сильных кандидатов, которые могут указывать на структурные вариации, управляющие фенотипом.

Генотипирование SNP-кандидатов идентифицирует гаплотипы, связанные с обоими признаками

Мы выбрали 123 SNP для дальнейшего генотипирования, включая все SNP-кандидаты, идентифицированные с использованием строгих критериев, представленных выше, дополненных дополнительными SNP, которые были кандидатами на более низкие пороги для фиксации. Все кандидаты на массу уха и тела были включены из строгого набора данных, и в общей сложности мы генотипировали 83 кандидата массы тела и 40 кандидатов уха (отмечены в дополнительном файле 3: Таблица S2).Мы генотипировали 288 образцов от 46 пород, включая 11 с стоячими ушами, 18 с промежуточными ушами и 17 с висячими ушами (Таблица 3), и проанализировали связь между частотами аллелей и фенотипом (Дополнительный файл 6: Таблица S4). На рисунке 1c показана значимость корреляций между массой тела и типом уха по всем SNP (полные результаты см. Также в дополнительном файле 7: Таблица S5).

Таблица 3 Гаплотипы, идентифицированные в генотипированных породах

Мы определили семь SNP в окне ~ 60 кб в CFA10: 11.02-11.08 Mb, который расположен непосредственно на 3′-м ‘гена MSRB3 , которые сильно связаны с типом уха. Большее количество SNP показало ассоциации с массой тела в большом (~ 400 kb) интервале (CFA10: 11.02-11.43 Mb), который охватывает область типа уха и простирается на 5′-конец гена HMGA2 (рисунок 1c). . Связь с массой тела слабее, но распространяется на гораздо больший регион. Наличие нескольких SNP с аналогичными уровнями ассоциации в этом регионе указывает на их принадлежность к LD.Таким образом, это дополнительное генотипирование позволяет нам дополнительно фильтровать список вариантов-кандидатов из исследования повторного секвенирования и выявлять несколько генетических вариантов, связанных с типом уха и массой тела в пределах сокращенного интервала.

Затем мы повторили ассоциации с массой тела в подмножествах данных, разделенных по типу ушей (дополнительный файл 8: рисунок S3). В соответствии с предыдущим эквивалентным анализом GWAS (дополнительный файл 2: рисунок S1) самые сильные ассоциации наблюдаются в пределах 18 пород с промежуточным ухом, причем ассоциации показаны в том же наборе SNP, что и у всех пород.Более слабые ассоциации с массой тела выявлены среди 11 пород с остроконечными ушами, тогда как среди пород с висячими ушами заметных ассоциаций с массой тела в этом регионе нет, хотя последний результат, вероятно, связан с низким количеством пород с маленькими ушами в наборе данных (Дополнительные файл 8: Рисунок S3). Эти результаты подтверждают, что вариации в этой области коррелируют с массой тела независимо от типа уха, предполагая, что эти два фенотипа контролируются отдельными генетическими вариантами внутри региона.

Мы выбрали 15 SNP с наиболее сильными ассоциациями с типом уха (необработанные p <10 −45 ) и / или массой тела (исходные p <10 −15 ), охватывающие 340 kb и предполагаемые гаплотипы, присутствующие в каждая выборка в этих SNP. Мы смогли вывести гаплотипы, присутствующие в 273 из 288 образцов. Всего мы выделили 29 различных гаплотипов. Шесть гаплотипов, которые присутствуют с частотами> 1,5% в наборе данных, показаны на рис. 3a, а встречаемость этих гаплотипов в каждой породе показана в таблице 3 (данные для всех гаплотипов представлены в дополнительном файле 9: таблица S6).Породы с висячими ушами преимущественно несут гаплотип D, что очень редко встречается у других пород (Таблица 4). Этот гаплотип несет минорный аллель для кластера SNP, связанных с типом уха, в 5′-части интервала. Гаплотипы S1 и S2 встречаются преимущественно у мелких пород без висячих ушей и редко встречаются у других пород. Эти гаплотипы несут минорные аллели для кластера SNP, связанных с массой тела, в 3′-части интервала. Гаплотипы L1 и L2 чаще всего встречаются у более крупных пород без висячих ушей, но также присутствуют и у других пород.

Рисунок 3

Структура гаплотипа, выведенная из 15 SNP, сильно связанных с типом уха или массой тела и паттернами неравновесного сцепления. a Расположение SNP на гаплотипе относительно генов MSRB3 и HMGA2 . SNP и гаплотипы, связанные с типом уха, выделены желтым, тогда как связанные только с массой тела выделены оранжевым. Отображаются только гаплотипы, присутствующие в наборе данных более 7 раз. b Попарные оценки неравновесия по сцеплению, измеренные как | D ’|

Таблица 4 Распределение гаплотипов среди пород

Эти наблюдения предполагают, что гаплотип D содержит один или несколько вариантов, которые вызывают висячие уши, тогда как гаплотипы S несут один или несколько вариантов, которые вызывают низкую массу тела.Связь между массой тела и вариациями гаплотипов в этой области слабее, чем с типом уха, что, вероятно, связано с присутствием дополнительных модификаторов в другом месте генома, особенно в локусе IGF1 [20, 21]. Рекомбинантные гаплотипы, которые несут подмножества SNP, связанных с типом уха и массой тела, наблюдаются, хотя крайне редко (<1%) и гомозиготы не наблюдаются. Породы, которые имеют как висячие уши, так и низкую массу тела, несут смесь гаплотипов D и S (Таблица 4, Дополнительный файл 9: Таблица S6), предполагая, что этот фенотип не вызван фиксацией гаплотипа, обладающего как висячим ухом, так и низкой массой тела. варианты.

Мы проанализировали попарную LD между 15 ассоциированными SNP, используя оба | D ’| (Рис. 3b) и r 2 (Дополнительный файл 10: Рисунок S4). Эти анализы выявили два блока почти идеальных LD, соответствующих 5 ‘и 3’ кластерам SNP, которые связаны с типом уха и массой тела соответственно. Внутри этих кластеров среднее значение | D ’| между SNP составляет 0,96, а среднее значение r 2 составляет 0,88. Два блока также находятся в сильной LD друг с другом, измеряемой | D ’| (среднее значение | D ’| между SNP из разных блоков равно 0.88). Это отражает очевидное отсутствие рекомбинантных гаплотипов в регионе (рис. 3b). Однако корреляция между SNP в этих двух блоках гаплотипов, измеренная с помощью r 2 , ниже (среднее значение r 2 = 0,23; дополнительный файл 10: рис. S4), что отражает наблюдения, что существует три основных гаплотипа и что аллели связаны с типом уха и массой тела редко встречаются в одном и том же гаплотипе и поэтому не сильно коррелированы.

Породы, которые мы генотипировали, включали две пары пород, которые, как известно, являются близкородственными, но различаются в некоторой степени по типу ушей.У норвич-терьера больше стоячих ушей, чем у близкородственного норфолк-терьера. Эти две породы считались одной породой клубами собаководства до 1960–1970-х годов. Папийон имеет более стоячие уши по сравнению с породой фален, и эти две формы могут появляться в одном помете. Однако явно не было никакой дифференциации этой области между этими парами пород, и наиболее ассоциированные с ушами SNP были гомозиготными по типу уха во всех четырех из этих пород (дополнительный файл 6: таблица S4).Норвич и норфолк терьеры преимущественно обладают гаплотипом S1, тогда как фален и паппиллон оба обладают смесью гаплотипов L1 и S1 (Таблица 3). Поэтому маловероятно, что генетическая изменчивость в этом регионе контролирует различия в типе ушей между этими конкретными породами.

Сравнение с генетической изменчивостью волков выявляет предполагаемые сигналы отбора.

Затем мы проанализировали область CFA10 на предмет сигнатур выборочных зачисток. Мы оценили уровни гетерозиготности у собак и F ST между собаками и волками по геному в окнах размером 40 т.п.н. (рис.4а). Одна область ниже MSRB3 и выше HMGA2 демонстрирует гетерозиготность ниже 1% перцентиля и F ST выше перцентиля 99% по сравнению с окнами в 40 т.п.н. во всем геноме собаки (11,15–11-25 МБ), что потенциально указывает на выборочную развертку. Область 11.0–11.1 Mb показывает очень высокую гетерозиготность, которая согласуется с присутствием двух гаплотипов, соответствующих фенотипам с висячими ушами и остроконечными ушами в этой области. Мы использовали данные как захвата последовательности, так и последовательностей WGS, чтобы идентифицировать генетические варианты, которые были зафиксированы у собак и волков в этом регионе (рис.2, Дополнительный файл 11: Таблица S7). Мы идентифицировали 45 таких вариантов в области секвенирования 3 Mb, из которых 12 сгруппированы в области 26,7 т.п.н. на CFA10: 102 — 10943326 в пределах гена MSRB3 . Плотность SNP в этой области составляет 2,2 kb / SNP, тогда как в остальной части региона она составляет 130,5 kb / SNP (точный тест Фишера p <2.2e −16 ). Эти SNP близки к кластеру SNP, который наиболее сильно коррелирует с типом уха (рис. 4b).

Фиг.4

Паттерны генетической изменчивости и кандидатные SNP. a Вариация гетерозиготности у собак и F ST между волками и собаками в области 3 Mb на CFA10, охватывающей критический интервал, связанный с ушами и массой тела. Обе статистики были измерены в окнах размером 40 Кбайт. Горизонтальные пунктирные линии представляют значения отсечения для процентилей по всему геному. Область с чрезвычайно высоким значением F ST и крайне низкой гетерозиготностью (11.15–11–-25 Mb) отмечена вертикальной пунктирной линией. b Подробное изображение SNP, наиболее связанных с типом уха, которые сгруппированы ниже гена MSRB3 , и SNP, фиксированных для альтернативных аллелей между волками и собаками, включая кластер SNP в гене MSRB3 . Связанные с типом уха SNP расположены в сайтах, которые картируются с транскриптами lincRNA в геноме человека, тогда как кластер фиксированных SNP собаки-волка обнаруживается в интронах MSRB3 . Также показаны консервативные элементы GERP, полученные из сопоставления с 39 человеческими млекопитающими [50]

Функциональные кандидаты

Мы определили наборы SNP, тесно связанных с типом уха и массой тела соответственно, и другой набор, который имеет сильно дифференцированные частоты аллелей между собаками и волками.На рисунке 4b показано расположение семи SNP, связанных с типом уха, и 12 SNP, дифференцированных между собаками и волками, в непосредственной близости от гена MSRB3 . Связанные с типом уха SNP в области CFA10: 11,02–11,08 МБ находятся непосредственно ниже гена MSRB3 (CDS: 10,88–11,02 МБ) и на 260 т.п.н. выше HMGA2 (CDS: 11,34–11,48 МБ).

Катализируемое MSRB3 восстановление сульфоксидов метионина до метионина важно для слуха [22], несинонимичная замена в этом гене вызывает глухоту, а экспрессия MSRB3 во внутреннем ухе локализуется в слуховом и вестибулярном сенсорном эпителии.Следовательно, есть доказательства того, что MSRB3 может участвовать в функции уха, и SNP потенциально могут оказывать свои функциональные эффекты на морфологию уха, изменяя его экспрессию, хотя предполагаемый механизм неуловим. Мы не идентифицируем совпадения между какими-либо SNP и элементами с эволюционными ограничениями. Точно так же ни один из SNP не находится в пределах известной кодирующей области. Интересно, что хотя предыдущие эксперименты с RNA-seq во многих тканях не идентифицировали транскрипцию в этой области [23], все семь SNPs лежат в пределах координат кандидатов lincRNA человека, картированных в собаке.Следовательно, эти варианты могут участвовать в регуляции экспрессии генов с помощью lincRNA и потенциально могут влиять на экспрессию MSRB3 или HMGA2 . Кластер фиксированных SNP собаки-волка в пределах гена MSRB3 ограничен интронными областями, и SNP не обнаруживают перекрытия с консервативными элементами или кодирующими нуклеотидами. Любые функциональные последствия этих SNPS, скорее всего, будут нормативными.

SNP во всей области гаплотипа размером 340 т.п.н. демонстрируют сходные уровни ассоциации с массой тела.Они включают кластер SNP в интроне гена HMGA2 , который является сильным кандидатом на участие в вариациях массы тела и коррелирует с несколькими морфологическими фенотипами, включая рост у людей [24, 25]. Один из этих SNP, CFA10: 11 364 385, находится в консервативном элементе и является хорошим кандидатом для влияния на массу тела путем воздействия на экспрессию HMGA2 . В геноме человека этот SNP отображается в положение (chr12: 66 247 497), перекрывающее метку h4K27Ac в клетках HUVEC, что указывает на функцию в эндотелиальных клетках.Он также обнаруживается в сверхчувствительном кластере DNaseI, наблюдаемом в нескольких типах клеток, и в сайте связывания фактора транскрипции РНК-полимеразы II, анализируемом с помощью ChIP-seq [26] во многих клеточных линиях, что позволяет предположить, что он влияет на транскрипцию.

Какие наследственные синдромы связаны с почечно-клеточной карциномой (ПКР)?

  • Рак почки: Введение. Cancer.net. Доступно по адресу https://www.cancer.net/cancer-types/kidney-cancer/introduction. Август 2019; Дата обращения: 18 февраля 2021 г.

  • Кэмпбелл М. Т., Йонаш Э., Вуд К. Г., Таннир Н. М.. Почечно-клеточный рак. В: Kantarjian HM, Wolff RA, ред. Руководство по медицинской онкологии М.Д. Андерсона . 3-е изд. Нью-Йорк, Нью-Йорк: образование Макгроу-Хилл; 2016. 733-52.

  • , переулок

    , BR, Canter DJ, Rini BI, Uzzo RG. Рак почки. В: Девита В.Т. младший, Лоуренс Т.С., Розенберг С.А., ред. Принципы и практика онкологии ДеВиты, Хеллмана и Розенберга . 10-е изд. Филадельфия, Пенсильвания: Wolters Kluwer Health; 2015 г.865-84.

  • Саймон Дж. У., Маршалл Ф. Ф. Почка и мочеточник. В: Abeloff MD, Armitage J, Niederhuber J, Kastan M, McKenna W, eds. Клиническая онкология . 2-е изд. Нью-Йорк, Нью-Йорк: Черчилль Ливингстон; 2000. 1784-99.

  • Рак в цифрах и фактах 2021. Американское онкологическое общество. Доступно по адресу https://www.cancer.org/content/dam/cancer-org/research/cancer-facts-and-statistics/annual-cancer-facts-and-figures/2021/cancer-facts-and-figures- 2021 г.pdf. Дата обращения: 18 февраля 2021 г.

  • Ху Дж, Мао Й, Уайт К. Почечно-клеточная карцинома и профессиональное воздействие химикатов в Канаде. Оккуп Мед (Лондон) . 2002 май. 52 (3): 157-64. [Медлайн].

  • Cho E, Curhan G, Hankinson SE и др. Проспективная оценка использования анальгетиков и риска почечно-клеточного рака. Arch Intern Med . 2011 сентябрь 12, 171 (16): 1487-93. [Медлайн].

  • Гонсалес ХК, Ламерато Л., Роджерс К.Г., Гордон СК.Хроническая инфекция гепатита С как фактор риска почечно-клеточного рака. Dig Dis Sci . 2015 июн. 60 (6): 1820-4. [Медлайн].

  • Cheungpasitporn W., Thongprayoon C, O’Corragain OA, Edmonds PJ, Ungprasert P, Kittanamongkolchai W, et al. Риск рака почки у пациентов с камнями в почках: систематический обзор и метаанализ. QJM . 2015 Март 108 (3): 205-12. [Медлайн].

  • Эпидемиология эпидемиологического надзора и конечные результаты.Информационные бюллетени SEER Stat. Национальный институт рака. Доступно по адресу http://seer.cancer.gov/statfacts/html/kidrp.html. Дата обращения: 18 февраля 2021 г.

  • Леви Ф., Ферлай Дж., Галеоне С. и др. Изменяющаяся картина заболеваемости и смертности от рака почки в Европе. БЖУ Инт . 2008 апр. 101 (8): 949-58. [Медлайн].

  • Робсон К.Дж., Черчилль Б.М., Андерсон В. Результаты радикальной нефрэктомии при почечно-клеточной карциноме. Дж Урол .1969, март, 101 (3): 297-301. [Медлайн].

  • Робсон Дж. С.. Достижения в лечении заболеваний почек. Практикующий . 1969 Октябрь 203 (216): 483-93. [Медлайн].

  • Motzer RJ, Mazumdar M, Bacik J, Berg W., Amsterdam A, Ferrara J. Выживаемость и прогностическая стратификация 670 пациентов с запущенной почечно-клеточной карциномой. Дж. Клин Онкол . 1999 17 августа (8): 2530-40. [Медлайн].

  • Heng DY, Xie W., Regan MM, Warren MA, Golshayan AR, Sahi C, et al.Факторы прогноза общей выживаемости у пациентов с метастатической почечно-клеточной карциномой, получавших препараты, нацеленные на фактор роста эндотелия сосудов: результаты большого многоцентрового исследования. Дж. Клин Онкол . 2009 г. 1. 27 (34): 5794-9. [Медлайн].

  • Альбигес Л., Хакими А.А., Се В., Маккей Р.Р., Симантов Р. и др. Индекс массы тела и метастатическая почечно-клеточная карцинома: клинические и биологические корреляции. Дж. Клин Онкол . 2016 6 сентября [Medline].

  • Zisman A, Pantuck AJ, Wieder J, et al.Алгоритм оценки группы риска и клинического исхода для прогнозирования естественного течения болезни у пациентов с хирургически удаленным почечно-клеточным раком. Дж. Клин Онкол . 2002, 1 декабря. 20 (23): 4559-66. [Медлайн].

  • Лучиани Л.Г., Цестари Р., Таллариго С. Побочная почечно-клеточная карцинома, характеристика возраста и стадии, а также клинические последствия: исследование 1092 пациентов (1982–1997). Урология . July 2000. 56: 58-62. [Медлайн]. [Полный текст].

  • [Рекомендации] Национальная комплексная онкологическая сеть.Руководство NCCN по клинической практике в онкологии. Рак почки. NCCN. Доступно на http://www.nccn.org/professionals/physician_gls/pdf/kidney.pdf. Версия 2.2021 — 3 февраля 2021 г .; Дата обращения: 18 февраля 2021 г.

  • [Рекомендации] Масса почек и локализованный рак почки: Рекомендации AUA. Американская урологическая ассоциация. Доступно на http://www.auanet.org/guidelines/renal-mass-and-localized-renal-cancer-new-(2017). 2017; Дата обращения: 18 февраля 2021 г.

  • Sauk SC, Hsu MS, Margolis DJ, et al.Светлоклеточная почечно-клеточная карцинома: многофазная мультидетекторная компьютерная томография помогает прогнозировать генетические кариотипы. Радиология . 2011 Декабрь 261 (3): 854-62. [Медлайн].

  • Alt AL, Boorjian SA, Lohse CM, Costello BA, Leibovich BC, Blute ML. Выживаемость после полной хирургической резекции множественных метастазов почечно-клеточного рака. Рак . 2011 г. 10 января [Medline].

  • Alt AL, Boorjian SA, Lohse CM и др. Выживаемость после полной хирургической резекции множественных метастазов почечно-клеточного рака. Рак . 2011 г. 1. 117 (13): 2873-82. [Медлайн].

  • Haramis G, Mues AC, Rosales JC и др. Естественный анамнез новообразований коркового слоя почек во время активного наблюдения с периодом наблюдения более 5 лет. Урология . 2011 Апрель 77 (4): 787-91. [Медлайн].

  • Загория Р.Дж., Петтус Дж. А., Роджерс М. и др. Отдаленные результаты после чрескожной радиочастотной абляции почечно-клеточного рака. Урология . 2011 июн.77 (6): 1393-7.[Медлайн].

  • Law TM, Motzer RJ, Mazumdar M, et al. Рандомизированное исследование фазы III интерлейкина-2 с лимфокин-активированными клетками-киллерами или без них в лечении пациентов с запущенной почечно-клеточной карциномой. Рак . 1995 Сентябрь 1. 76 (5): 824-32. [Медлайн].

  • Motzer RJ, Michaelson MD, Redman BG и др. Активность SU11248, многоцелевого ингибитора рецептора фактора роста эндотелия сосудов и рецептора фактора роста тромбоцитов, у пациентов с метастатической почечно-клеточной карциномой. Дж. Клин Онкол . 2006 г., 1. 24 (1): 16-24. [Медлайн].

  • SUTENT — капсула с малатом сунитиниба [вкладыш в упаковке]. Нью-Йорк: Pfizer Laboratories. 8/2020. Доступно в [Полный текст].

  • Motzer RJ, Hutson TE, Tomczak P, et al. Сунитиниб в сравнении с интерфероном альфа при метастатической почечно-клеточной карциноме. N Engl J Med . 2007 11 января. 356 (2): 115-24. [Медлайн].

  • Motzer RJ, Hutson TE, Tomczak P, et al.Общая выживаемость и обновленные результаты для сунитиниба по сравнению с интерфероном альфа у пациентов с метастатической почечно-клеточной карциномой. Дж. Клин Онкол . 2009, 1 августа, 27 (22): 3584-90. [Медлайн].

  • Гор ME, Szczylik C, Porta C, et al. Безопасность и эффективность сунитиниба при метастатическом почечно-клеточном раке: исследование с расширенным доступом. Ланцет Онкол . 2009 10 августа (8): 757-63. [Медлайн].

  • Рини Б.И., Коэн Д.П., Лу Д.Р. и др. Артериальная гипертензия как биомаркер эффективности у пациентов с метастатическим почечно-клеточным раком, получавших сунитиниб. Национальный институт рака . 2011 г. 4 мая. 103 (9): 763-73. [Медлайн]. [Полный текст].

  • Schmidinger M, Vogl UM, Bojic M, et al. Гипотиреоз у пациентов с почечно-клеточным раком: благословение или проклятие ?. Рак . 2011 г. 1. 117 (3): 534-44. [Медлайн].

  • Escudier B, Pluzanska A, Koralewski P, et al. Бевацизумаб плюс интерферон альфа-2а для лечения метастатической почечно-клеточной карциномы: рандомизированное двойное слепое исследование III фазы. Ланцет . 2007, 22 декабря. 370 (9605): 2103-11. [Медлайн].

  • Escudier B, Bellmunt J, Negrier S и др. Испытание фазы III бевацизумаба в сочетании с интерфероном альфа-2а у пациентов с метастатической почечно-клеточной карциномой (AVOREN): окончательный анализ общей выживаемости. Дж. Клин Онкол . 2010 г. 1. 28 (13): 2144-50. [Медлайн].

  • Саммерс Дж., Коэн М. Х., Киган П., Паздур Р. Резюме утверждения препарата FDA: бевацизумаб плюс интерферон для лечения прогрессирующей почечно-клеточной карциномы. Онколог . 2010. 15 (1): 104-11. [Медлайн]. [Полный текст].

  • Старк, Анджела. FDA одобрило первый биоаналог для лечения рака. Пресс-релиз FDA . 14.09.2017. Доступно на https://www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm576112.htm.

  • Sternberg CN, Hawkins RE, Wagstaff J, et al. Рандомизированное двойное слепое исследование фазы III пазопаниба у пациентов с запущенной и / или метастатической почечно-клеточной карциномой: окончательные результаты общей выживаемости и обновленная информация о безопасности. евро J Рак . 2013 апр. 49 (6): 1287-96. [Медлайн].

  • Motzer RJ, Hutson TE, Cella D и др. Пазопаниб в сравнении с сунитинибом при метастатическом почечно-клеточном раке. N Engl J Med . 2013 22 августа. 369 (8): 722-31. [Медлайн]. [Полный текст].

  • Mulcahy N. Сунитиниб против пазопаниба при раке почки в NEJM. Medscape [сериал онлайн]. Доступно на http://www.medscape.com/viewarticle/809733. Доступ: 26 августа 2013 г.

  • Escudier B, Porta C, Bono P и др.Рандомизированное контролируемое двойное слепое перекрестное исследование по оценке предпочтения лечения пазопанибом по сравнению с сунитинибом у пациентов с метастатической почечно-клеточной карциномой: исследование PISCES. Дж. Клин Онкол . 2014 10 мая. 32 (14): 1412-8. [Медлайн].

  • Hudes G, Carducci M, Tomczak P, et al. Темсиролимус, интерферон альфа или оба препарата для лечения прогрессирующей почечно-клеточной карциномы. N Engl J Med . 2007 31 мая. 356 (22): 2271-81. [Медлайн].

  • Motzer RJ, Hudes GR, Curti BD и др.Фаза I / II испытания темсиролимуса в сочетании с интерфероном альфа для лечения запущенной почечно-клеточной карциномы. Дж. Клин Онкол . 2007, 1. 25 (25): 3958-64. [Медлайн].

  • Motzer RJ, Hutson TE, Glen H, Michaelson MD, Molina A, Eisen T. и др. Ленватиниб, эверолимус и его комбинация у пациентов с метастатической почечно-клеточной карциномой: рандомизированное открытое многоцентровое исследование фазы 2. Ланцет Онкол . 2015 16 ноября (15): 1473-82. [Медлайн].

  • АФИНИТОР (эверолимус) [вкладыш в упаковке].Восточный Ганновер, Нью-Джерси: Novartis Pharmaceuticals. Март 2009 г. Доступно в [Полный текст].

  • Motzer RJ, Escudier B, Oudard S и др. Фаза 3 исследования эверолимуса при метастатическом почечно-клеточном раке: окончательные результаты и анализ факторов прогноза. Рак . 2010 сен 15. 116 (18): 4256-65. [Медлайн].

  • Motzer RJ, Escudier B, Oudard S и др. Эффективность эверолимуса при запущенной почечно-клеточной карциноме: двойное слепое рандомизированное плацебо-контролируемое исследование III фазы. Ланцет . 2008, 9 августа. 372 (9637): 449-56. [Медлайн].

  • Albiges L, Kube U, Eymard JC, Schmidinger M, Bamias A, Kelkouli N, et al. Эверолимус для пациентов с метастатической почечно-клеточной карциномой, резистентной к терапии анти-VEGF: результаты объединенного анализа неинтервенционных исследований. евро J Рак . 2015 11 августа [Medline].

  • Motzer RJ, Escudier B, McDermott DF, George S, Hammers HJ, Srinivas S и др. Сравнение ниволумаба и эверолимуса при почечно-клеточной карциноме на поздней стадии. N Engl J Med . 2015 5 ноября. 373 (19): 1803-13. [Медлайн]. [Полный текст].

  • Motzer RJ, et al; CheckMate 214 Следователи. Сравнение ниволумаба и ипилимумаба с сунитинибом при поздней почечно-клеточной карциноме. N Engl J Med . 2018 21 марта [Medline]. [Полный текст].

  • Choueiri T, Powles T, Burrotto M и др. Сравнение ниволумаба и кабозантиниба с сунитинибом в терапии первой линии для запущенной почечно-клеточной карциномы: первые результаты рандомизированного исследования CheckMate 9ER фазы 3. 2020 Виртуальный конгресс Европейского общества медицинской онкологии (ESMO) . 19.09.2020. Доступно по адресу https://oncologypro.esmo.org/meeting-resources/esmo-virtual-congress-2020/nivolumab-cabozantinib-vs-sunitinib-in-first-line-treatment-for-advanced-renal-cell-carcinoma- первые результаты рандомизированной фазы iii контрольного испытания 9er.

  • Choueiri TK, Escudier B, Powles T, Mainwaring PN, Rini BI, Donskov F, et al. Кабозантиниб в сравнении с эверолимусом при поздней почечно-клеточной карциноме. N Engl J Med . 2015 5 ноября. 373 (19): 1814-23. [Медлайн]. [Полный текст].

  • Choueiri TK, Halabi S, Sanford BL, Hahn O, Michaelson MD, Walsh MK и др. Кабозантиниб в сравнении с сунитинибом в качестве начальной целевой терапии для пациентов с метастатической почечно-клеточной карциномой низкого или среднего риска: исследование Alliance A031203 CABOSUN. Дж. Клин Онкол . 2017 20 февраля. 35 (6): 591-597. [Медлайн]. [Полный текст].

  • Escudier B, Eisen T, Stadler WM, et al.Сорафениб для лечения почечно-клеточного рака: окончательные результаты эффективности и безопасности подходов к лечению фазы III в глобальном оценочном исследовании рака почки. Дж. Клин Онкол . 2009 10 июля. 27 (20): 3312-8. [Медлайн].

  • Escudier B, Eisen T, Stadler WM, et al. Сорафениб при запущенном светлоклеточном почечно-клеточном раке. N Engl J Med . 2007 11 января. 356 (2): 125-34. [Медлайн].

  • Stadler WM, Figlin RA, McDermott DF, et al.Результаты безопасности и эффективности сорафениба для продвинутой почечно-клеточной карциномы расширили программу доступа в Северной Америке. Рак . 1 марта 2010 г. 116 (5): 1272-80. [Медлайн].

  • Verma J, Jonasch E, Allen P, Tannir N, Mahajan A. Влияние ингибиторов тирозинкиназы на частоту метастазов в мозг при метастатической почечно-клеточной карциноме. Рак . 2011 г. 1. 117 (21): 4958-65. [Медлайн].

  • Wu S, Chen JJ, Kudelka A, Lu J, Zhu X.Заболеваемость и риск гипертонии при применении сорафениба у онкологических больных: систематический обзор и метаанализ. Ланцет Онкол . 2008 г., 9 (2): 117-23. [Медлайн].

  • Рини Б.И., Эскудье Б., Томчак П. и др. Сравнительная эффективность акситиниба и сорафениба при запущенной почечно-клеточной карциноме (AXIS): рандомизированное исследование фазы 3. Ланцет . 2011 г. 3 декабря. 378 (9807): 1931-9. [Медлайн].

  • Рини Б.И., Плимак ER, Стус В. и др., Для исследователей KEYNOTE-426.Пембролизумаб плюс акситиниб против сунитиниба при почечно-клеточной карциноме на поздней стадии. N Engl J Med . 2019 21 марта. 380 (12): 1116-1127. [Медлайн]. [Полный текст].

  • Motzer RJ, Пенков К., Хаанен Дж., Рини Б., Альбигес Л. и др. Авелумаб плюс акситиниб в сравнении с сунитинибом при почечно-клеточной карциноме на поздней стадии. N Engl J Med . 2019 16 февраля [Medline]. [Полный текст].

  • Ravaud A, Hawkins R, Gardner JP, et al. Лапатиниб в сравнении с гормональной терапией у пациентов с запущенной почечно-клеточной карциномой: рандомизированное клиническое исследование III фазы. Дж. Клин Онкол . 2008 10 мая. 26 (14): 2285-91. [Медлайн].

  • Хаас Н.Б., Манола Дж., Уззо Р.Г., Флаэрти К.Т., Вуд К.Г., Кейн С. и др. Адъювант сунитиниб или сорафениб для лечения неметастатической почечно-клеточной карциномы высокого риска (ECOG-ACRIN E2805): двойное слепое плацебо-контролируемое рандомизированное исследование фазы 3. Ланцет . 2016 14 мая. 387 (10032): 2008-16. [Медлайн]. [Полный текст].

  • Ravaud A1, Motzer RJ1, Pandha HS1, Джордж DJ1, Pantuck AJ1, Patel A1 и др.Адъювант сунитиниб при почечно-клеточной карциноме высокого риска после нефрэктомии. N Engl J Med . 8 декабря 2016 г. 375: 2246-2254. [Медлайн]. [Полный текст].

  • Rini BI, Vogelzang NJ, Dumas MC, Wade JL 3rd, Taber DA, Stadler WM. Испытание фазы II еженедельного внутривенного введения гемцитабина с непрерывной инфузией фторурацила пациентам с метастатическим почечно-клеточным раком. Дж. Клин Онкол . 2000 июня 18 (12): 2419-26. [Медлайн].

  • Parekh H, Rini BI.Новые терапевтические подходы к почечно-клеточной карциноме. Expert Rev Anticancer Ther . 2015 17 сен. 1-10. [Медлайн].

  • Choueiri TK, Dreicer R, Rini BI, et al. Фаза II исследования леналидомида у пациентов с метастатической почечно-клеточной карциномой. Рак . 2006 декабрь 1. 107 (11): 2609-16. [Медлайн].

  • Patel PH, Kondagunta GV, Schwartz L, et al. Фаза II исследования леналидомида у пациентов с метастатической почечно-клеточной карциномой. Инвестируйте новые лекарства . 2008 июн. 26 (3): 273-6. [Медлайн].

  • Amin A, Dudek AZ, Logan TF, Lance RS, Holzbeierlein JM, Knox JJ, et al. Выживание с AGS-003, аутологичной иммунотерапией на основе дендритных клеток, в сочетании с сунитинибом у пациентов с неблагоприятным риском развития почечно-клеточной карциномы (ПКР): результаты исследования фазы 2. J Иммунный рак . 2015. 3:14. [Медлайн]. [Полный текст].

  • Рахма О.Е., Аштар Э., Ибрагим Р. и др.Пилотное клиническое испытание по тестированию мутантного пептида фон Хиппель-Линдау в качестве новой иммунной терапии при метастатической почечно-клеточной карциноме. J Transl Med . 28 января 2010 г. 8: 8. [Медлайн]. [Полный текст].

  • Чайлдс Р., Чернов А., Контентен Н. и др. Регресс метастатического почечно-клеточного рака после немиелоаблативной аллогенной трансплантации стволовых клеток периферической крови. N Engl J Med . 2000 14 сентября. 343 (11): 750-8. [Медлайн].

  • Mukund A, Gamanagatti S.Абляция почечно-клеточного рака этанолом для облегчения симптомов на поздних стадиях заболевания. Дж Паллиат Мед . 2010 Февраль 13 (2): 117-20. [Медлайн].

  • [Рекомендации] Донат С.М., Диаз М., Бишофф Дж. Т., Коулман Дж. А., Дам П., Дервиш И. Х. и др. Последующее наблюдение при клинически локализованных новообразованиях почек: Руководство AUA. Дж Урол . 2013 Август 190 (2): 407-16. [Медлайн].

  • Moch H, Humphrey PA, Ulbright TM, Reuter VE. Классификация опухолей мочевыделительной системы и мужских половых органов ВОЗ .4-е издание. Лион, Франция: МАИР; 2016. Классификация опухолей ВОЗ, том 8: 14-43.

  • [Рекомендации] Эскудье Б, Порта С., Шмидингер М., Риу-Леклерк Н., Бекс А., Кху В. и др. Почечно-клеточная карцинома: Руководство ESMO по клинической практике по диагностике, лечению и последующему наблюдению. Энн Онкол . 2019 г., 21 февраля (приложение 5): v58-v68. [Медлайн]. [Полный текст].

  • Гипертрофическая кардиомиопатия (ГКМП) | Американская кардиологическая ассоциация

    Гипертрофическая кардиомиопатия чаще всего вызывается аномальными генами сердечной мышцы.Эти гены заставляют стенки камеры сердца (левого желудочка) сокращаться сильнее и становиться толще, чем обычно.

    Утолщенные стены становятся жесткими. Это уменьшает количество крови, забираемой и выкачиваемой в организм с каждым ударом сердца.

    Препятствующий и беспрепятственный HCM

    При обструктивной ГКМП стенка (перегородка) между двумя нижними камерами сердца утолщается. Стенки насосной камеры также могут стать жесткими. Это может блокировать или уменьшать кровоток от левого желудочка к аорте.Этот тип есть у большинства людей с HCM.

    При беспрепятственном HCM основная насосная камера сердца все еще становится жесткой. Это ограничивает количество крови, которое желудочек может принимать и откачивать, но кровоток не блокируется.

    Признаки, симптомы и риски

    У некоторых людей с гипертрофической кардиомиопатией симптомы отсутствуют. Другие могут не иметь признаков или симптомов на ранних стадиях заболевания, но могут развиваться со временем.

    Важно знать признаки и симптомы HCM.Это может помочь в ранней диагностике, когда лечение может быть наиболее эффективным.

    Признаки и симптомы HCM включают:

    • Боль в груди, особенно при физической нагрузке
    • Одышка, особенно при физических нагрузках
    • Усталость
    • Аритмии (нарушения сердечного ритма)
    • Головокружение
    • Легкомысленность
    • Обморок (обморок)
    • Отек лодыжек, стоп, ног, живота и вен на шее

    ГКМП — хроническое заболевание, состояние которого со временем может ухудшиться.Это может привести к ухудшению функций и качества жизни, долгосрочным осложнениям и увеличению финансового и социального бремени.

    Людям с HCM часто необходимо изменить образ жизни, например ограничить свою активность, чтобы приспособиться к своему заболеванию.

    По мере прогрессирования HCM может вызывать другие проблемы со здоровьем. Люди с HCM имеют более высокий риск развития фибрилляции предсердий, которая может привести к образованию тромбов, инсульту и другим сердечным осложнениям. HCM также может привести к сердечной недостаточности.Это также может привести к внезапной остановке сердца, но это бывает редко.

    ГКМП считается наиболее частой причиной внезапной сердечной смерти у молодых людей и спортсменов в возрасте до 35 лет.

    Диагностика

    Гипертрофическая кардиомиопатия чаще всего передается по наследству. ГКМП — наиболее распространенная форма генетического заболевания сердца. Это может произойти в любом возрасте, но большинство из них получают диагноз в среднем возрасте.

    По оценкам, 1 из каждых 500 человек имеет ГКМП, но большой процент пациентов не диагностирован.Из числа диагностированных две трети имеют обструктивный ГКМП, а одна треть — необструктивный ГКМП.

    Кардиолог или детский кардиолог часто диагностирует и лечит ГКМП. Вас также могут направить в центр кардиомиопатии, где медицинская бригада проходит специальную подготовку.

    HCM диагностируется на основании вашей истории болезни, семейного анамнеза, медицинского осмотра и результатов диагностических тестов.

    Медицинские и семейные истории

    Знание вашей истории болезни и любых признаков и симптомов, которые у вас могут быть, — важный первый шаг.Ваш врач также захочет узнать, был ли у кого-нибудь в вашей семье диагностирован HCM, сердечная недостаточность или остановка сердца.

    Физический осмотр

    Ваше сердце и легкие проверят. Ваш врач будет прислушиваться к определенным звукам с помощью стетоскопа. Например, громкость, время и местоположение шума в сердце могут указывать на обструктивный ГКМП.

    Диагностические тесты

    Диагностика обычно проводится с помощью эхокардиограммы. Он проверяет толщину сердечной мышцы и кровоток от сердца.В некоторых случаях может быть выполнен другой тип эхокардиограммы, чреспищеводное эхо (или чреспищеводное эхо). ЧВЭ выполняется с помощью зонда, вставляемого в горло, когда пациент находится под седативным действием.

    Другие диагностические тесты могут включать:

    Диагностические процедуры

    Подтверждение диагноза или подготовка к операции может также включать одну или несколько медицинских процедур, в том числе:

    Лечение и лечение HCM

    В настоящее время не существует лекарств для лечения гипертрофической кардиомиопатии.

    Людям с ГКМП, у которых нет симптомов, рекомендуется изменить образ жизни и принимать лекарства от состояний, которые могут способствовать сердечно-сосудистым заболеваниям.

    Для тех, у кого есть симптомы, основное внимание уделяется устранению симптомов с помощью лекарств и процедур.

    Лекарства

    Лекарства, называемые бета-блокаторами, блокаторами кальциевых каналов и диуретиками, предлагают ограниченное и различное облегчение симптомов. Они могут помочь с функцией, но также могут иметь побочные эффекты.

    Процедуры

    Для лечения HCM можно использовать целый ряд хирургических и нехирургических процедур:

    • Миэктомия перегородки — Миэктомия перегородки — это операция на открытом сердце. Рекомендуется для людей с обструктивной ГКМП и тяжелыми симптомами. Эта операция обычно предназначена для более молодых пациентов и для людей, у которых не работают лекарства. Хирург удаляет часть утолщенной перегородки, которая выступает в левый желудочек. Это улучшает кровоток в сердце и по всему телу.
    • Алкогольная абляция перегородки (нехирургическая процедура) — В этой процедуре этанол (разновидность алкоголя) вводится через трубку в небольшую артерию, которая снабжает кровью область сердечной мышцы, утолщенную HCM. Алкоголь заставляет эти клетки умирать. Утолщенная ткань сжимается до более нормального размера. Риски и осложнения кардиохирургии увеличиваются с возрастом. По этой причине абляция может быть предпочтительнее миэктомии у пожилых пациентов с другими заболеваниями.
    • Устройства, имплантированные хирургическим путем — Хирурги могут имплантировать несколько типов устройств, чтобы улучшить работу сердца, в том числе:
      • Имплантируемый кардиовертер-дефибриллятор (ICD) — ICD помогает поддерживать нормальное сердцебиение, посылая электрический разряд в сердце, если обнаружено нерегулярное сердцебиение. Это снижает риск внезапной сердечной смерти.
      • Кардиостимулятор — Это небольшое устройство использует электрические импульсы, которые заставляют сердце биться с нормальной частотой.
      • Устройство для сердечной ресинхронизирующей терапии (CRT) — Это устройство координирует сокращения между левым и правым желудочками сердца.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    Можно использовать следующие HTML-теги и атрибуты:
    <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <s> <strike> <strong>